Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1357
Length(NT) : 1013
Best Gene Model Blast : Link to GSTUMT00002887001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001588083.1| Score: 1213 E_value: 1e-131
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG09893.1 Score: 1154 E_value: 1e-125
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2276 Score: 990 E_value: 1e-108
PFAM Definition: Peptidase_M20, Peptidase family M20/M25/M40. This family includes a range of zinc metallopeptidases belonging to several families in the peptidase classification. Family M20 are Glutamate carboxypeptidases. Peptidase family M25 contains X-His dipeptidases..
Pfam Number: pfam01546 Score: 175 E_value: 2e-13
Swissprot: Q9P6I2|CPGL_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1357
TTGGTCCGCTCTTCTTGGTAAATATTTTATCAAGTCCTCACTTCCCCATA
CATCCTTCCAACACTCTCCCTTACGACTTATTGGCCAGAAGTTCGCTAGG
CTGCAGTTCCATACCCAAACTATAGACTACTTTTCTGAGAGAGCAAGCAT
GGCTCCGCAACTTGACGGTTACTTTAAGCAGGTAGATTTGATGGCGGACT
CGTTCATCAATCGCCTTCGTTCCGCCGTTGCTATCCCGTCGGTATCGGCT
GATCCGGGCTTGCGTCCCAAGGTTGTCGCAATGGCTGATTTTCTCGAAAA
GGAGCTCAGGGCTCTGGGTGCTTCAGTTGAGAGACGTCTGCCCGGGAAGC
AGCCCGGCCATCCTGACCTCGACCTTCCTCCTATTCTTTTGGGTAGATAC
GGTAATGACGCCAAGAAGCGCACCATCTTAGTCTACGGGCACTACGATGT
CCAGCCTGCTTTGAAGGAAGATGGATGGGCTACTGAGCCTTTTGACTTGA
CCATAGATGAGCAAGGCAGGATGTACGGAAGAGGTAGCACCGATGATAAG
GGTCCTGTCCTCGGTTGGATCAATTCCATCGAGGCCCATCAGAAAGCTGG
CGTTGATTTCCCCGTAAACCTTTTGATGTGCTTTGAAGGAATGGAAGAAT
ACGGTTCCGAAGGTCTCGACGACGTAATTAAAGAGGAGGCGAGTAAATTC
TTCAAGGACGCAGAGGCTGTGTGCATTTCCGACAACTATTGGCTTGGAAC
CAAGAAACCATGTTTGACATACGGTCTTCGAGGATGCTCGTACTACTCGC
TTGCTGTTTCGGGACCTGGTCAAGATCTGCACTCCGGTGTCTTTGGCGGG
ACGGTTACTGAGCCCATGACAGACCTTGTTAGGTTGCTCGCAACTCTCGT
TGGTAATAAGGGAAAAATCCACATTCCCGGCTTGAACGAACTCGTTGCTC
CTTTGACCGACGAGGAGAAGGAGCTATACAAGGATATCAGTTTTGAGATG
TCAGATCTGTATC

Sequences in the Contig:

SY0AAA46YK12FM1 SY0AAA48YF21FM1 SY0AAA48YH12FM1
SY0AAB26YI06FM1 SY0AAB53YG09FM1 SY0AAC58YP22FM1
SY0AAC61YH24FM1 SY0AAD16YE21FM1 SY0AAD36YC19FM1