Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1356
Length(NT) : 1155
Best Gene Model Blast : Link to GSTUMT00004603001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 109 E_value: 7e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1356
TTGGTGTTTTCCTTCCCACCTTACAATATGATACCCCATCCCTCCAATCA
TGAAACCGCGCTCTACGAATGTATATACCTCATCGTTTCAAATGCCCGCA
CGGGCAGAGCCATTCTATTTGAAATGAAAAGAATAAATTCCCCTCCCTTC
CACCTCAATGCCCGGAGGTGGGTGGTCAGTGAAGCTGGGCTAGGAAAGAG
TATGAAGCAAGACTTCGCCTCCTTCTTCAATCCTTTATTTTTCGCTTCGA
CAGCCGCAGCGGTACTCTTGCATCCTGCTCATGTGATCGAGTGAGATCGA
GACCAACAAGCAAAGAAAGAAAGCTAGTGAGCAAGAGGGAGGGCGGTTAA
AAATATTATATTTTGTTTTAGGGGTCGAAGGGAGTTTTTTTCAAGAGGCT
TGGTATTGGTCTTTTTACTCTTACTACTTCCGGTGAGCACGCTAGGGGTT
TGTGGGAGATAAAGAGGAGGGGAAAGAAGGCGACGGTGGAGCACAGGTAA
ATCACCCGTACTTTAACCCACAAACACCGCAAACAGGGAGAGATAAAGAA
GGAAGGAACGCTAGGCTGGATCTCGACTTCAAAAATTGTATCGCCATTAT
TCACAGTACTAGAGAGCGTCAATACTATCATACCACCGCACCGCCAACGT
TACCGCTATTGTCGCCGGCTGCAAACCACCAAGCAGACAAACCGGATACT
TACCGACGGACGGGGGAACCCCGCTCACGACAATTCACGCAGTGTCACCA
CCACCACCACCACCACTAACACCACCATTAAGCTACTAAACAATCTAACA
AAGACCCACCAAAATGTCAATCTGGGCCTCCAAACCCACCCCGCCAACGC
CCCCGCTCCACACGACCGGAAAAACTTACCACTCAACCCTCCTCCTCCTC
CTCGCACACTCCCTCGAGCCATTCCCAGCACCGGCGCCGGACCCTGGCCA
AATAATCGAAGTTCCCTCGCTCCTGCCGCCGCCCCCGCACCGGCGCACAT
TTCCAGCTGCGTCCGCGCCCTCGCGTGGAAGGAGCACCCGCGTGTCGGTG
AGGAAGGACAGTTCCTGGTGGGAGGAGCACGGCGGTGAAGCGCTCCGGGT
GAGGGAGGAAGTTGACGACCTCCAGCATGACTTGAGGCTCGCAGCCCGGT
TGCAG

Sequences in the Contig:

SY0AAA11YC18FM1 SY0AAA24YF11FM2 SY0AAA48YH11FM1
SY0AAD51YE11FM1