Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1355
Length(NT) : 658
Best Gene Model Blast : Link to GSTUMT00012109001 E-value : 1e-150
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_04719
Accession: ref|XP_001245278.1| Score: 178 E_value: 1e-11
KEGG Definition: hypothetical protein
Accession: ang:An09g06540 Score: 177 E_value: 8e-12
KOG Definition: No Hit Found
PFAM Definition: Nnf1, Nnf1. NNF1 is an essential yeast gene that is necessary for chromosome segregation. It is associated with the spindle poles and forms part of a kinetochore subcomplex called MIND..
Pfam Number: pfam03980 Score: 184 E_value: 8e-15

Sequence:
>Contig1355
TTGGCCACAACCCAGCTCCATCACGCTAAAAAAAAACCCGCATCAACCCA
CCACAATCACGCAGCAAATGTCCGATCCAAACCCACCACCACCACCACCC
GCATCGACAACAGAGCCAGACCCAGAGGAAGAGTTAGCAGAAGGCATCCG
TGCGACCGCCCTCCGCAACATCTTCACCGCGGCCCTCGACCGCAGCATAA
AAACGTGCTCGTACGAGAACTTTGCCGCATGCTTCCCAACCCCGGCGCGG
CGCGCGCCGGGCGTTCTCAGGAACGCCTGGGAGCAGATGTGCGGGTTTTG
GGATAGCAGTGCTAAAGTTCGGTACCCTCGCTCTGTACAGGAGGGAATGG
AATGAATGAAAGAAGCAGTGGCTAATTTCAAAGATACATAGAGAGAATAC
GAAACCATCCTGAAAGAACGGAACGTGGTTGCTGGTCTGAATGCTCTTGA
CGAATTAACTAAAGAAGCGGAGGAGCGCAGAGCGACAGCTGCGCCTGGGG
AGATTGCCATTTCTCCATCGACATTACCTCCAGTGACTATTCTCACGGCA
CAGCTCACGCCACTACTACTCGCCGCGCAGAAGGAGGTCGCGGGCAAGAT
TGAGGTTGTGCAGGGAACTAATACCGAGTTAATGGGGAAGATCGAGACCC
AGAGGCAG

Sequences in the Contig:

SY0AAA20YJ10FM1 SY0AAA48YG18FM1