Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1353
Length(NT) : 2042
Best Gene Model Blast : Link to GSTUMT00002352001 E-value : 0.0
Numbers of ESTs : 135

Blast Results:

Nr Definition: hypothetical protein BC1G_07084
Accession: ref|XP_001554496.1| Score: 418 E_value: 1e-38
KEGG Definition: hypothetical protein
Accession: fgr:FG01450.1 Score: 416 E_value: 9e-39
KOG Definition:
Classification: [Signal transduction mechanisms, General function prediction only].
Kog Number: KOG4019 Score: 172 E_value: 7e-13
PFAM Definition: Calcipressin, Calcipressin. Calcipressin is also known as calcineurin-binding protein, since it inhibits calcineurin-mediated transcriptional modulation by binding to calcineurin's catalytic domain..
Pfam Number: pfam04847 Score: 318 E_value: 9e-30
Swissprot: P53806|RCANL_CAEEL
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1353
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGACCCAACTTTTTGGACCA
ACCAAAAAGGAACCAAAAAAAAAAAAGTCTGCTACCATAGTAAGCTAGTC
TTTATTCCACACAGGCAGCGTCATCCACATCACTACTTAACTGACCAACG
CTCCCCATCTCCTCAGCAACCTTCAACCTTCACAACCGCAACATCTCACC
TCACACCTCCATCAAACAAAGACCGAAGACCAATTCAAACAATGGAGTCC
CCAAAACTCTCCCCCGCTGTATCCCCCCTATCCACACCAAACAGATCTAG
AACGTCATCCCGTGGCTCACACCTAACTCTCGACCTCTCCTCCTTACCAC
CACTCACTCAGCCAGCAACACCCACAAACACGCTTCTAATAACCAATCTC
ATAAACCCCTCGATCTTCGACTCACCCCACCTGCAGCAACTCCGCAGCGT
AATCGAGTCCTCGGCAACACTAGTCTCCTGGTCCCCGCTAAAGTCCTTCC
GGCGGATCGTGTGCTCCTTCGCGACGACGGAGGACGCCATTAGTGTGCGC
CAGGTGCTGGATGGCGAGGCAATCATGGGAGACCGTGCACGTGTTTACTT
CGGCGAGCACACACCCGTACAACCGGTGGACCAGCACCTACAGGCGCCGG
AGTCGAAGAAGCTCTTCTTCATCTCGCCCCCGCCCTCGCCGCCACACGGC
TGGGAGCTGCGCAACGAGGAGCCGCCGAATGCCGTCGTCGTCGCAGAGGA
CTTGGCGCGGGCGCTCGCGCGGCTGGATTGGGTGAGGGCTGGTAAGAGTA
ATACTAGAGACAGCGGGGTGGATGGTGCTAGTGGCACGGAGGCGGGGGGA
GTGTCACCCACCTGCCGCCCTAGGTCCGCCAGCTCCGTCGTCCTATTCGA
GCCGGAGGAGGTCGGGGATGGCGAGAAGAAGATGCCCGCCATATCCGTTG
ATGATTATACCGATTCCGGAGACGAGGCGAGTCCTGTTTCGCCGGTGGCT
CCGGTATCGCTACACACGGCCAGACCACCCGTCGAGCTTATTCAGGACGC
TTAGATTTACTTGCTTTCTTTCCTTTCCCTTTTTTTTTTCTTTTGCTTGC
ATCAAATTTTTAATATGGATGGAGCGGTTGTGGGTTCTATAGTTAACTGA
GGTGGATGGAAGGGCGTCTTTCAGGTGTTTTAACTGATGTTTTGTCTTTT
CTTTTCTTTTCTTTTCTCTTTACGGGTGTCCGGGGGGGTGTACTCGGGGT
GGGGGTGAAGTATTGGGACAAGCAGGGGGCTTGATGTCTGTGTGAATTAC
TTGAAGTGGGATTGAAGATACCAATTTGAGTAATTTGCACAGACATCTAA
CCCCCCTGCTCGTCCCAATACTTTCCCCCTACCCTAGTATTCGTGCAAGA
CAAGGATTGTTTTGCTCGTTCACTACCCCTGTCTTGTACGAATACATCTC
TCCGGGTACCGTACTCGTAGAGTCAAAGCGTTTTTAAAAAGGACTGCTAT
TGCATACCGCCAAGACTTGGCCATTTTGTTTGGATCTGGGTGGTATGTGA
TAGTAGCTCTTTTTCAAAGCACTTCTACTCTACGAGTAACTATACACATT
TTCCTGTTTTTCTCTTCTTCTGCAAGATGTAGAACAGGAAATGCGGATTA
TTACTATTGGGTTCGGTCTAGTCTAGTCTAGTCAGCGGATAAGGGAGTTT
TCTTTCCTTTCCTTTTCCTTTTGTTTGTTCTGCATCCCTCTCTTTTTCAA
TCTTTTATCCCAATCCAGTAAAGTACAGTACATCATTAACCCTCCAACTC
AGTAAATATTTTTTCCTCCTTCAAAAGTTTTATCTGCCAAGTTGTTAGTT
CATGGTCAGGGTTTTCATTAAATTCCTTCTCTCTTTTCGTTACTGCCATT
TTCGTCACTGCGCCGCATCGTGTTGTGCGGCAGTAAAGGGCGTTCGGCTC
CGGTGTCGGAGAATAACTTTTCCGAGTGCCAAGTTTCCCGTGGTCCGCCA
GATGTGTATGCAAAAAATGGCGACACACACGAAACCTGCATC

Sequences in the Contig:

SY0AAA10YO23FM1 SY0AAA11YK10FM1 SY0AAA13YB15FM1
SY0AAA16YL11FM1 SY0AAA18YL17FM1 SY0AAA19YO20FM1
SY0AAA22YC10FM1 SY0AAA22YH21FM1 SY0AAA25YA22RM1
SY0AAA28YB11FM1 SY0AAA28YM03FM1 SY0AAA30YA12FM1
SY0AAA31YH22FM1 SY0AAA32YG13FM1 SY0AAA32YG13RM1
SY0AAA33YC24FM1 SY0AAA36YH01FM1 SY0AAA36YJ10FM1
SY0AAA37YI06FM1 SY0AAA3YF17FM1 SY0AAA40YJ17FM1
SY0AAA41YA10FM1 SY0AAA41YG24FM1 SY0AAA46YE20FM1
SY0AAA48YB01FM1 SY0AAA48YF22FM1 SY0AAA49YN09FM1
SY0AAA4YJ14FM1 SY0AAA4YJ22FM1 SY0AAA50YF07FM1
SY0AAA53YM20FM1 SY0AAA54YL10FM1 SY0AAA57YB18FM1
SY0AAA57YF07FM1 SY0AAA57YH10FM1 SY0AAA57YO01FM1
SY0AAA59YH19FM1 SY0AAA59YI19FM1 SY0AAA5YA02FM1
SY0AAA61YE02FM1 SY0AAA61YF24FM1 SY0AAA62YC19FM1
SY0AAA63YI02FM1 SY0AAB11YE04FM1 SY0AAB11YK07FM1
SY0AAB13YM06FM1 SY0AAB13YM13FM1 SY0AAB14YN04FM1
SY0AAB17YJ24FM1 SY0AAB20YJ13FM1 SY0AAB22YJ12FM1
SY0AAB25YK13FM1 SY0AAB25YP21FM1 SY0AAB31YG14FM1
SY0AAB34YG20FM1 SY0AAB36YC19FM1 SY0AAB36YH22FM1
SY0AAB37YH15FM1 SY0AAB37YP08FM1 SY0AAB38YJ11FM1
SY0AAB38YK23FM1 SY0AAB3YD18FM1 SY0AAB45YE24FM1
SY0AAB46YC10FM1 SY0AAB46YM11FM1 SY0AAB49YF05FM1
SY0AAB50YD04FM1 SY0AAB52YH19FM1 SY0AAB58YD24FM1
SY0AAB58YP08FM1 SY0AAB5YA01FM1 SY0AAB60YI14FM1
SY0AAB9YH13FM1 SY0AAC10YG15FM1 SY0AAC11YC09FM1
SY0AAC15YM09FM1 SY0AAC16YI23FM1 SY0AAC19YA17RM1
SY0AAC19YG05RM1 SY0AAC20YM04FM1 SY0AAC21YF20RM1
SY0AAC21YI10RM1 SY0AAC31YJ11FM1 SY0AAC31YO24FM1
SY0AAC33YP21FM1 SY0AAC35YA08FM1 SY0AAC35YP14FM1
SY0AAC37YK20FM1 SY0AAC38YC17FM1 SY0AAC39YF23FM1
SY0AAC3YD21FM1 SY0AAC42YJ23FM1 SY0AAC42YL19FM1
SY0AAC45YD05FM1 SY0AAC46YO11FM1 SY0AAC47YP12FM1
SY0AAC48YO20FM1 SY0AAC4YD10FM1 SY0AAC50YO13FM1
SY0AAC52YE18FM1 SY0AAC53YI24FM1 SY0AAC54YK13FM1
SY0AAC54YL07FM1 SY0AAC56YH08FM1 SY0AAC57YF20FM1
SY0AAC59YE01FM1 SY0AAC60YL08FM1 SY0AAD14YK22FM1
SY0AAD17YA21FM1 SY0AAD17YO12FM1 SY0AAD18YL21FM1
SY0AAD19YA04FM1 SY0AAD1YM10FM1 SY0AAD20YP03FM1
SY0AAD23YP22FM1 SY0AAD24YP03FM1 SY0AAD27YE07FM1
SY0AAD32YE16FM1 SY0AAD40YL04FM1 SY0AAD41YP02FM1
SY0AAD42YB19FM1 SY0AAD46YJ10FM1 SY0AAD47YA22FM1
SY0AAD48YC08FM1 SY0AAD48YI19FM1 SY0AAD49YK20FM1
SY0AAD51YH14FM1 SY0AAD53YB12FM1 SY0AAD55YL21FM1
SY0AAD55YO03FM1 SY0AAD59YN04FM1 SY0AAD60YH03FM1
SY0AAD61YB23FM1 SY0AAD61YC22FM1 SY0AAD61YH10FM1