Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1352
Length(NT) : 700
Best Gene Model Blast : Link to GSTUMT00007822001 E-value : 1e-109
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 170 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: ani:AN8457.2 Score: 150 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1352
TTGGGAAAACTCTCCCCTTCTGTTATTGTGCGCGAAATATCGAGGATCCT
GTTTGACGTTATACCGTATGTTTGATCCTTGCTATTGATGCAGACATCAC
TCATCTCGAACGCTTAGAGTTGGCGTGTTGCAGGCCGGTTGGACTCTCGA
CTCTGGTGAAAAACCAAGAGGAAGATCAGAAAGAAGAGAAGAAAACAGAA
CGGTACTAGTCAAAGAATAAGTGTACGAGCTGAGTAAGTGTAGCACTTTG
ACGTACCAAACGTCAGAGTTCTGGTAAGAATAATTTCCAATCCCGCCCAA
GGCCTAAAGTACTCAAGTGCTTTAGAGAAACAAGCCAATTGTTACCCCAC
CGATAGGTAACGAAATTCGCTTCCAGACGACCGAGACGACAAGTTCGGCT
CAAGCCAGGAGTTCGGTTCGCTAGAGGCAGTACGGGGGAGACTCGAGCCG
CAAGATCTTCATATCCAAATAATAGACTGGGGGGTACTGTAGATTAGAAA
TCATGCGTCGGTTTATGAGGGCAGGTGTGCAGAAGATAATAGGCCCAGAT
CATCAGGATAGCACAAGGAACATCAATAACCAGGGTGTAGCACTGCACCA
GCAGGGGAAGTACGATGAAGCCGAGATATTGCATCGAAGTGCATTAGGCG
ACCGAGAGAAGGCGCTTGGGCTAGATCATCGAGATACGCTAAATAGTGTG

Sequences in the Contig:

SY0AAA41YB13FM1 SY0AAA48YF16FM1