Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1351
Length(NT) : 1191
Best Gene Model Blast : Link to GSTUMT00000951001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1351
TTGGCACTCCAATACACCCCTATTTGGCTTCAACAATGGCGCGAGCGATC
TCAAATCCCCCATATCAGAGCCCACACCATCGGTTCGATCAACCGAGATA
GGCCCCTCTCCCCCATCATTCAGTCCGTTGTCATCCGACCGGGCGACTCT
AGACTGTAGCGCTGACCAGCAAACCGTAAACTCGATCTTCGACCCATCAG
CCACCCAAACCTCATTACCTCTAGAGCAAACTCCTATATCGCCGGTGGTC
GATATTGCATCTAATGAGAATATGTTTGGCAATTGGAACGACCTCATCGA
GGATGAGACTATCTGGAATCTTGAGAGGGTCTAATGGCAATCGAACAAAA
CAATTCTAGTGAAGTAATCACTGGCCGCAGGTTTAACCGGCACGTAGCGT
GATGGGAAACATCTCTTATTATCTAGCATGATTTCTTCGGGTCTATTGCC
AATTGGACTTTTTTTACTTTTTTTATCACCATTTCCATTCCCCGGCTTGG
GTGTTGCTTCCTCCCACCCCCTCTCTTCCTCTATGTGATTTCAATATCAT
AGCATGGGACTTGAACTTCGAATCGGTAAAATAATTCATGGGAACATCGG
TTTTTTCCTTCCCCCCCTCTTTCTTTGTCTCAACGTTTTTCTACCTATTA
GTTCCTTTTTGTTAGGTGGGGGTTCCAGGCGCCATATTACTATTGTTTTT
TGAACCACCTTTTTTTATATCATTTTCCTCTGCCCCTCGTCCTCGGTCTT
TCTCAGGAAAAGGAGGGAAATGAAAAGCCCAAAAATTCGATTGGCCCCTT
AGTTTCCTCCTCTTCTCAATACCTCAATTATTTCCTTATTTCTTAATGCT
TTTTTCGCCCCTGCGCGCTTTTAAGTACGGGCGGTCTCTGACTGGATTGG
ACCGGATTGGACCGGATTGGACTGAATTGGGTAGACCGATACCCATCTCT
TCCGGCGATCCTATTGTTCCTTGTCTTTCCCTAATTTCATTTCTATTTCC
CTAGCATCATCGACAGAACTGAAGGAACGCAGCAGATGGAACGAATGGGG
AGGAGACTGAAGAAGACCTGTGAACTCTTTTTCTTTTACCTTTGTTACTG
AAACTTTTTCCCTTTCCTTTCTTTCCTTCTATTCTACTTTATCCCTGAAG
GCTATTAGATGTATATAAAAACATTATGGCAAGACAGACAG

Sequences in the Contig:

SY0AAA48YF15FM1 SY0AAC51YA18FM1 SY0AAD14YP01FM1
SY0AAD43YN10FM1 SY0AAD58YM08FM1