Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1350
Length(NT) : 762
Best Gene Model Blast : Link to GSTUMT00005143001 E-value : 1e-154
Numbers of ESTs : 3

Blast Results:

Nr Definition: mitochondrial folate carrier protein Flx1, putative
Accession: ref|XP_001270030.1| Score: 268 E_value: 6e-22
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03974 Score: 238 E_value: 9e-19
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0764 Score: 207 E_value: 2e-17
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 199 E_value: 2e-16
Swissprot: P40464|FLX1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0015230 = Molecular function: FAD transmembrane transporter activity
GO:0015883 = Biological process: FAD transport

Sequence:
>Contig1350
GAAAAAATGGTTCATCACTCATTCATCAAGGAACAAAATCCCCCCACGCC
TTCTTTATTTCTACTTCTCTCTTTCACCCCTCCCCCACCTTCCTCCTTCC
CTTGTTATCTTACTATTCTCCATGAAAGAACACCAGAATTGGATACCCTC
CATTCTGGTGGAGACAATCGCCGGTTTCACAGCAGGTTTCCTATCGACAC
TTGTTGCTCACCCATTAGACCTCGTCAAAGTTAGGTTGCAAGTCGACAGG
GAAAGCAGAACGCCAAAGCTTGGAGCAACGTGGAGGATAGCTCGTAATGT
TGTTGCAAACGAGGGGAGGGGCGCGCTTTATCGGGGCTTCTCACCAAACC
TGGCGGGTAACATGACGAGCTGGGGCTTGTTTTTCATGCTGTATGTCTCG
TCTTGCCACAAGGTTTTGTCACTGGTGCGAAATCAAATATACACCCTTCT
TGACAACCGGTGACCTTGTTTTTTTCTTTTCCTTTTTTCCCTCTCATTTC
TTGTCTATTTTTGAAAGTTTGAAAGTTCGGTTCCTGATTGTGACTCAAAT
GCGGCTGGGTTGTGTGGTGAGCGATAAAGGTATGGCGAGATCAAATCGAG
AGTGACAAATCATAAACAAGGAGGCCTTTCCTCAATCGATTACCTACTCT
CTTCCGGGACTGCCGGTGTCTTGACAGCGATTTGCACGAATCCACTCTGG
GTGGTCAAGACGCGGATGCTCTCTTCGGGTCGGTCGGTTCCTGGGGCTTA
CTTAGGTCTTAC

Sequences in the Contig:

SY0AAA48YE22FM1 SY0AAB52YJ21FM1 SY0AAD4YA11FM1