Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig135
Length(NT) : 855
Best Gene Model Blast : Link to GSTUMT00008527001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_04700
Accession: ref|XP_001556984.1| Score: 267 E_value: 1e-21
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05693 Score: 206 E_value: 6e-15
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1759 Score: 132 E_value: 1e-08
PFAM Definition: MIF, Macrophage migration inhibitory factor (MIF)..
Pfam Number: pfam01187 Score: 143 E_value: 7e-10

Sequence:
>Contig135
GCTAAGATAGCAATTCGGGGGTCTGCGATACCGGTATCCAATCCACACCT
CGCCTCGATATCGCTCGCGTGGGCACCCATTTTAGCAGGGGAGAGAACTT
TCGTTCTTAAAGCAACCTTCTTCCCCATCCTTCACTTGAGCCCTCCGTTC
CTTCAACAAAAAACCTTTTTATCTAGCTAGCTTCACGAGTAACTTCAGAC
ATGGCAACCCTAGAACCAGCCAAACCCGCAGACTCTGAGTCGAAGAAAAA
CCCCCAGCTTCCGGCCGGTCGAACACCTCCTTCACCAGCTCCCACAAACA
TGTCTTTCAAACAAGGTGATGATCGGGATGTCACTCGCAGACCTGAATCT
ACACGATCCCCAACCGCCATTCATTTTACGACCAGAGATATCGAGAAGGA
TTCCCCCGCTACTGGGGGATTGTCCAAGAAGTCTTCGAAGGGAGACTTTA
GCAGGAAGAAGTCCATGAAGGGAGCAAGTTACTACGGGGAGGTATTCGCC
GTTCGGGAGTCGGGCCCGGTGGTTCCCAAGAGCTCTGCGGTTTGGGTTGA
ATTGCGAACAAACGTCATTCTAGAAAACGAATTCGATTTCGCAAAGTCAT
TATCCGAGCTGGTCGCTAAACGCTATGGAAAGACTGAGGATGCTGTCTGC
GTATCTATTGAACACTCGGCCTGTATGGTGATGGGGGGCACATATGATGG
ATCCTTTCTCTTAACTATCACTTCCCTAAACATGATTTCTCCGACATGCA
ACAAGCGAAATGCGGCGTTGATCGGTGATTGGGTCAGCAATAATCTCAAT
GTTGAAGTCGCTAGGGGCTACATCCGTTTCGTCGACCCAGATTTTGCGAA
TTACG

Sequences in the Contig:

SY0AAA15YA18FM1 SY0AAA23YN18FM1 SY0AAA43YJ10FM1
SY0AAA62YJ14FM1 SY0AAB5YK01FM1 SY0AAC12YH01FM1