Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1349
Length(NT) : 857
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 11

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1349
TTGGGACGAACTTGAACTGCATGCTCGGGGAAAAAGAATAACGCTCTTCT
CCATCCAACTCGCCCTTCATTTTCCACCCAGATAAATAAAAACGTCACTG
CTCCGCATGCCGGCCTACTCTGTCCTAAAATCTACCTTTCTTGTACTCTC
AGAATCTACCGGTCGCCTGCAGAACTTCTGAATATCTCCATCCCTCAATA
TTCATTGATTCTTTCGACTTTGTGTCGTCTGAGCGTTCAACTGTGGGCTG
GCAATACACGGACACGGACCGGAACACCAACGGGCGGATAGCGAAAAGTC
AGACCGAAAGACAGATTGGTGCCTTGCCTACGTGGAATTACGGACCTGCG
GTACCTGACCTGGCTGCTGGTTAGCGTGTGATGGGAGAGAGGTAAAAAGG
ACACCTCGCGAGGTTTTTCCCCCTATCGGTGGTCCATCCTATTTCTCTTA
CCACCGAGACCTTCAACTTCAGCTTTCTGCTTGGCTTCAACACTCTGCAT
CCTCACAAAAGAGTACCTGCTGTGTTTTTCCTTTTTTGCTACCGCATTTC
GGTAGACTGCCGAATCACCGTCAGCTGCTCTCTTTTCAACCCCCCACCTA
ATAGAAAAAAAAATAAAGAAAGAAAAAAAAAAGGTTTTCAACGCTAGACG
TGTTTTCCCCTCTATAAGCAGTTGCTACTGCTGTTTGACGGGATGGTTAT
CATAAACCTCCCCACACGTCTCGGACGCTCCAAGACCAGTGCGTCGAAGA
ATAGCTCTAAAAACCCCTCGCCAATACCCAGTCGGACCGGGTCACCAAAA
CTCATGAACGATAGTACTCTAGTTTTGAAGGCCACGGCGGTCCAAGGTCG
AAACTTG

Sequences in the Contig:

SY0AAA21YO07FM1 SY0AAA25YP03FM1 SY0AAA27YF12FM1
SY0AAA38YC11FM1 SY0AAA42YL01FM1 SY0AAA48YE20FM1
SY0AAA62YG06FM1 SY0AAB20YA18FM1 SY0AAB43YF03FM1
SY0AAB50YP15FM1 SY0AAB61YO22FM1