Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1348
Length(NT) : 1566
Best Gene Model Blast : Link to GSTUMT00006241001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_03575
Accession: ref|XP_001595486.1| Score: 1045 E_value: 1e-115
KEGG Definition: hypothetical protein
Accession: fgr:FG07150.1 Score: 1015 E_value: 1e-111
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2178 Score: 949 E_value: 1e-103
PFAM Definition: NAD_kinase, ATP-NAD kinase. Members of this family include ATP-NAD kinases EC:2.7.1.23, which catalyses the phosphorylation of NAD to NADP utilising ATP and other nucleoside triphosphates as well as inorganic polyphosphate as a source of phosphorus. Also includes NADH kinases EC:2.7.1.86..
Pfam Number: pfam01513 Score: 531 E_value: 1e-54
Swissprot: Q6LA56|YF4B_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1348
TTGGCCCCCCTCCCCCCTCCCCCACCACCAACTGATAGGGGGAATAAAAA
CGAAGATAACATTCGACCCCCACGTCCAAGCCGCCCGCCGCCGCAAATCT
TCCATCGTATCCGTCGATGAGATGGGGAATCCCTTGCTCCCTAGATTCCT
CAATAATCATGACAACAGCGACGATGACAAGGGTATCGGTGCTGGTACAA
AGAGCAGTTGTTTTGTGCATGCGTTGCTGGAAATGCGGAATCAGTTTGTT
CCAGTGGGGGGTGGGAGTGGGAGTGGTGGGGAGGTGGAGGGGAAGGAGGG
AGATAGGGTTGTTGCGGCACATAGAAATCCGCCATTTATGACTAAGAGTG
AACTATCGGATATGGTTATGGGGGTAAGGGAGTTGAGTAAGCATTTAGAT
GAATGTTCGCGCTATTATGATCTTGACGAAGACTTATGATAAAGCACTGG
TCGGGTATACGAGGAGGTTGGTGGAGTGGTTGTTGGGCGGGGAGAGGGGG
AGCAAGCACACTGTATACGTCGAGGACGTCCTCAAAGATGCACCAGAATT
CGATATGGAGGGGCTCGTAGAAAAGTGTCCCGGATATAAATCCAGATTAC
GTTTCTGGACCGCCGAGTTATGTGCTAAGAGGCCACATACTTTTAATTTT
GTCATCACTCTTGGAGGCGATGGCACAGTCCTTTACGCGAGTTGGCTGTT
CCAGAAAGTTGTCCCGCCGGTGTTCTCCTTCGCTCTGGGGTCCCTGGGAT
TCCTGACAAAGTTTGACTTCTGCACGTTCGAAGACACACTATCTACTGCC
ATACGGGATGGTGTGACTGTTGGGCTACGCCTGCGCTTTGAGGGCACCAT
CATGCGCAGGGTAAATAATAACAAAGACTTTGACAGAAGCGAAGACATTG
CCAACGAGATCTTCTCCGGAGCGGCACTCCACCCGCCGACTCATACGGCA
GGGGAGTCGTTTATTGTATTGAATGAGATTGTGGTGGATAGGGGGCCTAA
TGCTACTATGTCTTCAACGGAGTTGTATGGTGACAATATGCACTTGACGA
CGATTCAGGCGGATGGGGTTTGTATTGCGACGCCGACCGGGTCGACAGCA
TATAATCTTGCCGCTGGAGGTTCACTCTGCCACCCGGAGATTCCGGCAAT
TTTGGTCTCCCCGATTTGTGCCCATACTCTTACCTTCCGCCCTTTGATAC
TGCCAGACTCGATGGTTGTCCGCGTTGCTGTTCCGTGCGATGCACGGACT
ACTGCTTGGGTATCATTTGATGGGCGACAGAGGATAGAATTGAGCCAGGG
TGACTACGTAATGGTCTCGGCATCCCGATTCCCATTCCCGGCGGTGCAGA
GCAAGCCCGATAACAAAGACTGGTTTGACTCGATTCGACGAACGATGAAC
TGGGGATCCAGACCGAGACAACAAGCGTTTTCTTGAATCTACGACACCAG
GACGGTAGTTGAAATGTTTTTTTTATTCGGCTGCTATGTGGTGCTTGGGA
TATGTTGGCCTGGGTGCGTTACCGGTTTTTTTCTTTGATTTTCTGTACGG
CTAGTACTATAACGAC

Sequences in the Contig:

SY0AAA12YI04FM1 SY0AAA24YM10FM1 SY0AAA24YM10FM2
SY0AAA48YE16FM1 SY0AAA62YF05FM1 SY0AAB42YD16FM1