Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1347
Length(NT) : 1429
Best Gene Model Blast : Link to GSTUMT00004299001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: hypothetical protein FG08900.1
Accession: ref|XP_389076.1| Score: 501 E_value: 2e-48
KEGG Definition: hypothetical protein
Accession: fgr:FG08900.1 Score: 501 E_value: 8e-49
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2981 Score: 632 E_value: 2e-66
PFAM Definition: Autophagy_C, Autophagocytosis associated protein, C-terminal domain. Autophagocytosis is a starvation-induced process responsible for transport of cytoplasmic proteins to the vacuole..
Pfam Number: pfam03987 Score: 321 E_value: 3e-30
Swissprot: Q4WUE5|ATG3_ASPFU

Sequence:
>Contig1347
TTGGGTCCCGTGAGACTTGAATGACTGTCGCTCTGCCCTGCCCTCTTCGC
CCCGCTCACCCTTTATAATTTCGAACGCTACACTTACTCTCCACCTTACC
TCCCATACTTAAACACCCGCCCTCGCAATATCAACTGTTATCGCAACATA
TAAATTTAACAAGGCTCTAAACTGCTGGAAAGCGAGCAAACAACATGAAT
CTCTATTCCACTATTATGTCGATACAAGAGTACATCTCAAGTCCCTCACA
TACCTCGACCTTCACCAGCACTGGCCAGCTCACCCCGGAAGAGTTCGTCG
ACGCTGGGGACTTTCTCGTCTACAAGTTCCCCACTTGGAGCTGGCAGCCA
GCTGCCCCGGGAAAGAGCGTTACCCATCTACCTGAAAACAAGCAGTTCCT
AAAGCTCCGTCACGCTCCATGCCATTCTCGTCTTGATGATAGTTTTTCTC
CTTGGAATCCTGGTGAGGCTATTGAGGGCGTGGATGAGTGGGAGGACAAC
ATTCCTATCAAAGATGGGGACCCTCCAACCTCTGCCAAAGTAAGGACCGT
AGATGACAAAGGCGTCGAGGAAGAAGAGGAGGAGGACGAGGAAATCCCAG
ATATGGATGACGATGAAGAGGATGACGATGAAGCCATCATCAAGGAGAGC
GTAAAGGGAAAGAGCGCAGACGGAAAGTCTGGAAAATCACCCCTACGCTT
CTACAACCTTTACCTTGCTTACTCCAAATACTACCGTACCCCACGTCTAT
ACATCTCTGGGCACGACGGGGCAACAGGGCTCCCACTCACCCCACCTACG
GTTATGTTCGAGGACATCGCTCCCGATTACCGCGAGAAGACTGTAACTAT
TGAAGAGTTCCCTCCGGAGGGCACACTTATGGCAACTGTGCATCCATGCA
AGCATGCTGAGGCTATGAAGCGTATCTTCGACAGCATGCTCCGACGCAAA
GAGCGGGAAGAATGGGAAGAGGTGCCTCCCGCAAATTCCGAGGATAAAGA
AGATGAAACAGCTGTCAGAGTGGATATTGATAGCGGACTAAGAGTTGACC
AGTACATGATTGTGTTCGTCAAGTTCATAGCCGGTGTCGTTCCTGGGGTG
GAAATGGATTATACCATGAGCATCTAAGCTAGGAGGATTCAGATGGGTTT
CTAATACCTCCTTTACTTTCTCGTGTCCTTTTTAGCACTACCTTCTTATG
GATGGTTGAGGGCTGCACGGGGCTCTGATTTTACTTTTTTGACATTTTCC
TTCTTTTAAGTTGCACTTTTACTTTACTTTATTCGCTGTATGAAGGGGTT
TGTGGTGTTTTGTTGCATTTTGAGATATAGGAAGCTTCTTCCCTTTCCCT
TCTCTTTTACGTGTAGTTACTGTAGCTATTGCTTTCTGGTCTGAGTGAAT
CGAGTAGTTATACATGCTTACATCTTTAG

Sequences in the Contig:

SY0AAA48YE14FM1 SY0AAA52YL07FM1 SY0AAB38YD06FM1
SY0AAB51YM04FM1 SY0AAC23YA05FM1 SY0AAC31YF05FM1
SY0AAC35YH17FM1 SY0AAC38YI12FM1 SY0AAC45YD11FM1
SY0AAC51YJ18FM1 SY0AAD25YK19FM1 SY0AAD39YH04FM1
SY0AAD41YK16FM1 SY0AAD52YB17FM1