Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1346
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00003288001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_07144
Accession: ref|XP_001797496.1| Score: 468 E_value: 3e-45
KEGG Definition: ubiquitin-conjugating enzyme E2; K10704 ubiquitin-conjugating enzyme E2 variant
Accession: aor:AO090003000999 Score: 462 E_value: 8e-45
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0896 Score: 494 E_value: 7e-51
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 194 E_value: 5e-16
Swissprot: O74983|MMS2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0042803 = Molecular function: protein homodimerization activity
GO:0006301 = Biological process: postreplication repair
GO:0016567 = Biological process: protein ubiquitination

Sequence:
>Contig1346
TTGGCAACACCAGGCAATTTGCCATTTGCTTTTCAAGGGAACTCATCCTA
ACGAAAAACCGCCTCCCGAAACTTTACCAACTCTTTTAGTTAAGATGGTC
GCTAAAGTTCCTAGGAACTTTCGCTTGCTCGAAGAGCTAGAGAAGGGCGA
GAAAGGGTTGGGTGCTGATGGTTGCTCTTATGGTCTACAGGATGGAGACG
ACGTGATGATGTCTAACTGGAATGCTACCATTCTGGGACCTCCCCACAGC
ACCCACGAGAACCGCATTTACAGTTTGAAAATACACTGTGGAGATTCCTA
CCCAGACGAACCCCCGGTGGTCCACTTTATATCTAAAATCAATCTTCCCG
GTGTTGATCCTAATAATGGCAAGGTCGACCTACTCAAACTGGGTCGTGTG
AGCCAATGGAACAGGGATAACACTATGGAGAAAATCCTTGTGGCTTTGAG
GGAACACATGGCCAGCCCGAATAACAGAAAGGTCCATCAGCCCCCCGAAG
GTACTACCTTTTAATTTTCGCGTATTTTCATTTTACTATCATACTATTAT
GGATGCATGAGCTTCCTAGGGGTTTCTCGGTTCTGTGTTTGGCAATTCAA
GTAGTTACATGGCTTCTGCCATATAGGCTTGCCGTGCTCTCTCGATCTCA
TATCGGTGTCTGTTTC

Sequences in the Contig:

SY0AAA48YE11FM1 SY0AAB61YF17FM1 SY0AAD38YD05FM1