Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1345
Length(NT) : 1420
Best Gene Model Blast : Link to GSTUMT00005626001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_07166
Accession: ref|XP_001591720.1| Score: 192 E_value: 1e-12
KEGG Definition: hypothetical protein
Accession: mgr:MGG_13058 Score: 185 E_value: 3e-12
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2072 Score: 364 E_value: 3e-35
PFAM Definition: Caldesmon, Caldesmon..
Pfam Number: pfam02029 Score: 300 E_value: 8e-28

Sequence:
>Contig1345
TTGGGGAGAGAGAACAAAAAGAGCGAGCTAAACTTGATAAGGACCAACTC
GAGCAAGAACGGATAGCCAAGGAACGAGAGAAGCGAGACCGTATTGAGAA
GGAACGCCTCGAGAAGGAGCGTATCGAACAGGAACGAATAGCCAAAGAGA
AGGAGGAGCGGGAACGGCGGGCGAAAGAGGCTACTCACCGGGTACGGGCA
GAGAAGGAGAGACTCGCTAAGCAACGAGCCGAGGAAAAAGAGCGGAAGCT
GGCTGAGGAAAAGGCTCGACGAGAACAAGAGGAGAGAGAGAACTCCGACC
ACTATAAAATGGTCAAAGAGAAGGAAAGGGCAATACGGGAGAAGCTTGAA
CAAGATCGCCTGCAACGAGAGGAAGCCGAAAGGCAGCAAGAGGCAGCCTT
GAGGGAAGAGGAGAAGAGGTTGGAGAAGGAGAGGGAGAGGCTAGCAAGGG
AAGCAGCGGAGCGAGTGCGAAAGGAGAACGAGGAGAGTGAAAAGTTTCGA
CGTGAGTTGATGGCGGAGGTAGAGGCTAGTAGAATCCAGGTCGAGAACGA
GAAGCGGGAGAAGGAGAAGAGGGAACGCTTAGAGCGAGAGCATGTGGAGA
AGGAGAGGGAGGAGAAGGAGGCCAAACAGCGAGCCGCTGCCGAAAGACTG
AAGCTGCAAAGGGAAAAGGCGGCTGCAAAGGCTGTTGAACGGGAGCGTCT
TGAGAAGGAGGAGCGAGAAAGGATTGAGATGCTTAAGGCAGAAAGAGAGA
GGCAGGAAAAGGAGCATGAACGGCAGAAGGTTGAGAATGAACGCATGGGA
CGTGCGGAATGGGAACGTCAACAGCAGCATCGCCAGCAAAGACTCACTAG
AGAACGGTCTGAACGGGCTAGCTGGGAACGAGAACGGTTGCCCTCAACGC
CCAAGAGAGCAGGTTCTCATTCCCCATCGAAAGCTGCATACCAAACACCC
CCTTCGTCTAACAGAAGGCCCATGTCGGATACTACTAACCTCCCACCTTC
CCCTGCAAAGCCGACCACCCCTGTGCCACCTAGGAAAAAGTCGTTCCATG
AGCACCACGATTCGCTGCCCCCAGTACCTCCACCTCACCGAGTGCTGTCC
TCTGAGTCTTCGTCGACATCAACCCGGAAATCACGCACTCCCCCGCCCCC
TCCTCCGCCTCCACATTCCTCAACTTCATCAGCAACTACATCTCCCCGCC
CGCTGCCACGGCAGCCCTATTCCAATTCTGATCCATCCAAGATTGTTCTG
AAGGCGGTATTCACGTTTACGGCTTCACAACCGTTGAAGCCACAATCGAC
GCTCATTCCAGGTCACGGTGGGCTCAGTGAAGGTTTAATTTTGAAGATGA
CCACTGAGGGGCTATTCATCGACGATGCTGTACGAAACCAGGCACAGCGC
GAATGGGATATCCTACCCAA

Sequences in the Contig:

SY0AAA48YE08FM1 SY0AAC19YC02FM1 SY0AAC28YO04FM1
SY0AAC34YL07FM1 SY0AAC37YD13FM1