Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1344
Length(NT) : 673
Best Gene Model Blast : Link to GSTUMT00010635001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_02569
Accession: ref|XP_001248798.1| Score: 653 E_value: 1e-66
KEGG Definition: Exocyst complex component Sec15, putative
Accession: afm:AFUA_6G05290 Score: 624 E_value: 1e-63
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2176 Score: 321 E_value: 9e-31
PFAM Definition: No Hit Found
Swissprot: O75006|SEC15_SCHPO

Sequence:
>Contig1344
TTGGGCAGGGTATCTCCAATTTGCGATCGCTCAAGATTAACTCTGCGTTA
GAACTTGTCCTAGATGAGCGAGAAGAGTTTGATGTTCTCGACAACGAAGA
CATAGCTATTGACTTCACACCCTTATTTGAATGCTTGCATATACATGAAG
CGATGGGACAGAGGGATGAGTTTAGGGTTACATACGCAAATGTTAGAAGA
CAACAGAAGGATCTCCTGTTTTCGAACCCACTTACCCTTACAAGTGAGGG
CGTAAGCTGTATCAGTCGTCTGCTGGAAGATGTGTGTGGTTTTGCAATAA
TTGAGAAATCTACACTTAAGAAAACTTTGGGTTTTCGTTCTCCAGTTGAT
GTTGATTATTTATGGGACTCGATGTGTAAGAAAGCGATAGTCATGATAAA
TCAAAAAGTGGAAAATGTCACCAAGGCAGAGATATTATTGAAAATAAAAA
ATGTATCAGTCTTGTTCATACAGACTATGGATACCTGGGAATATCCCGTC
AAGCACTTTGACGAATTCCTTCTCGGTCTTTTTGATCAGTACTCAGAATG
CTTGAAGAGGGACTTCATCAGCGAGTTCAAAAAGATTGCAATGAGCGACG
ACTACACACCTATGGTGGTTGAGAATCGGCCAAAGTATGACAATATTGTG
AAATCGGTCTGGTACAATCCAGA

Sequences in the Contig:

SY0AAA48YD21FM1 SY0AAB28YJ13FM1 SY0AAC31YK06FM1