Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1343
Length(NT) : 780
Best Gene Model Blast : Link to GSTUMT00008553001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1343
TTGGGACTTGGCGAGGCTGAAAGCCTTAAAACCTCAAGCAATCGCTCCCG
TTTACCGCAGTTGACGACTATTACGAGACTTTATAAACTCGGCGAGCACT
CTTCTTCTCCGGACTCTCTCGAAATTCGAAAGTGTCAAAGCGTACGGATA
CCCAGAGAGACTCTTGTCCTTCCAACTCTTACGACGAAAGAATTGCTATT
GCTACTACCACCTTCTGCATACAGTAACTTTCGTCCTCTCTCTACCACCA
CCACCACCAGAGCCAACACTCTTATCAAATATTCAACATGACCAAAGCTT
GGGACCGAGAGAAGTCGAGGATGCATGAGCTCTACATGGTCCGCAATATG
AAGTTATCCCAAATGCAAGAAATCATGCGGGAACAGCACGGCTTTACAGC
AAGTGAGCGGGCATACAAGCAAAAGTTTAAGGAATGGAAGTGGTTCAAGA
AAACTCCGCGCAACCAAGGAGTAAACCCAGACGCGATGACCATCAGCCTC
GGGCGACCGTCGCCCACTTCACGCTCGTACGGACACTCCAGCGCCGACCT
ACGAAGGTGTTCGGACTCGAGTTCTTTAAGTAGCATGGACCACCATCATG
GCCAGATGCCCCCCCCGACCCCGTATCCCGACCCAAGTGTAAGCCCCGAA
CATAGCGTTTATCCAGCTACTCAGCACAGCTTGTTGGGCTTGGGACCCGT
TCACAGTCCACAGCCGGTCGTTCGAGATACCTACCAAATATCGCTACCAC
CAGTGGCGGAGTTACAGTTGCTGCCTTTCA

Sequences in the Contig:

SY0AAA2YM13FM1 SY0AAA48YD10FM1 SY0AAA4YM01FM1
SY0AAB17YG14FM1 SY0AAB26YC19FM1 SY0AAB35YH17FM1