Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1342
Length(NT) : 1551
Best Gene Model Blast : Link to GSTUMT00010229001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: nitrite reductase
Accession: gb|ABI98041.1| Score: 2023 E_value: 0.0
KEGG Definition: nitrite reductase NiiA [EC:1.7.1.4]; K00362 nitrite reductase (NAD(P)H) large subunit
Accession: afm:AFUA_1G12840 Score: 1458 E_value: 0.0
KOG Definition: No Hit Found
PFAM Definition: NIR_SIR, Nitrite and sulphite reductase 4Fe-4S domain. Sulphite and nitrite reductases are vital in the biosynthetic assimilation of sulphur and nitrogen, respectfully. They are also both important for the dissimilation of oxidised anions for energy transduction..
Pfam Number: pfam01077 Score: 297 E_value: 2e-27
Swissprot: P22944|NIR_EMENI

Sequence:
>Contig1342
TTGGCTCATCGCTATTGGTACAGTAGCGAAGAAATATAGTTTGTATTGCA
AGATCACTGGTGGGCAGAGGATTGATATGTTCGGTGCGCGAAAACAAGAC
TTGGTGGCCATCTGGTCAGAGCTTGTAGAGGCGGGGATGGAGAGTGGGCA
TGCTTACGCTAAGAGTTTGAGAACAATCAAGGTTTGTTTTGCATTGACCT
CGATTCTCGAAACTCGCTGATAGTGTTATCCAAGAGCTGTGTAGGGACTA
CATGGTGCCGCTTCGGTGTCGGCGACAGTGTTGGCATGGCAATCAGGCTG
GAAGAGCGGTACAAAAGTATTCGTGCGCCACATAAAATTAAATCTGGTGT
TTCGGGATGTATTCGGGAATGTGCAGAAGCCCAGAACAAAGACTTCGGCC
TTATTGCCACCGAGACAGGGTACAACATCTTTGTTGCTGGAAACGGGGGC
TCCAAGCCTCGCCACTCCGAACTCTTAATCAAGGATTGTCCCGTAGAAAG
GGTTATCCCGATCCTGGACCGCTACCTAATGTTCTACATCCGTACCGCAG
ACAGGCTCCAGAGAACAGCCCGCTGGATTGAAAATCTCCCGGGAGGAATC
AAATACCTAAAGGAAGTAATCCTGGACGACAAGCTCGGGATTTGCGACCA
GCTCGAAAAGGAAATGCAAGACTTGGTGAAGACCTACTTCTGCGAATGGA
CGGAAGTTGTGAAAGACTCAGAGCGACGAAAACAATTCCAGCAATTTGCC
AACACCTCCGACGCCAGCGAGACCGTAGAAATTATCAACGAGCGCTCCCA
ATCCAGGCCAACATACTGGCCCAAAGGAAGTGTAAAATACGACTTCAAAA
ACCACCGCTGGTCAAATCTAGCCTGGCAACCCATCATCGAAGCCTCATAC
TTCTCTAGCGCGAATCTCTCAACACCCGTAACTGCTGCGGTCAAGCGGGG
TGATACCCAGCTCGCCATCTTCAAAGTGAGAGGCAAATACTACGCCACCC
AGCAGATGTGTCCTCACAAGCGGGCCTTCGTCCTCTCGGACGGCCTGATA
GGCGAAGACCCGGACGACGGCACGGAAGAGTGCAAGGAGAAGAGGAAAAT
GTGGGTCAGTTGCCCGTATCACAAGAGGAACTTCACACTTGACGGCAAGA
CTCCCGGCGGATGTGCGAACGACGAAGAGGTCAGTATTGCGACGTTTGAT
GTGGAAGAGAGAAGTGACGGGTGGGTTTACTTGAAGTTGCCGAGTGTGGC
GGAGTTGGACGCCTTGCTAGGGACCGAGAGGTGGAAGGTCAAGAAGGAGG
AGTCGGAAGATCCGTTTAAGGACATGGACAAAAAGATTAATAGTAGTAAC
AAGGGACGGAAGGCTGTTAAGCCCACCGAGGCCGCGGGTGGGAATGGAAG
TCCGACGGAGAAGAAGATCAATGGGCTAGAGTGGTAGAATGGGCATGGGT
GTACTCTTTTTGTGCTGTACATATATGGTTTTATTCTCGGAGTTTTGTAG
AACTGTCCTAGGAGATACACGAACCTCCTGTTAAATTTCAGCTGCCTCTC
T

Sequences in the Contig:

SY0AAA10YI23FM1 SY0AAA26YO03FM1 SY0AAA3YG21FM1
SY0AAA43YN15FM1 SY0AAA48YB21FM1 SY0AAA4YK15FM1
SY0AAA58YO12FM1 SY0AAA5YF12FM1 SY0AAA6YA15FM1
SY0AAB40YN14FM1 SY0AAB45YL21FM1