Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1341
Length(NT) : 1433
Best Gene Model Blast : Link to GSTUMT00010482001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_03392
Accession: ref|XP_001243951.1| Score: 1429 E_value: 1e-156
KEGG Definition: 5'->3' exoribonculease Dhp1 [EC:3.1.11.-]; K01146
Accession: afm:AFUA_1G13730 Score: 1403 E_value: 1e-153
KOG Definition:
Classification: [Replication, recombination and repair, RNA processing and modification].
Kog Number: KOG2044 Score: 829 E_value: 3e-89
PFAM Definition: No Hit Found
Swissprot: Q8TFZ1|XRN2_ASPFU

Sequence:
>Contig1341
TTGGCAGAAAGGCCATCGCGCCGAGGAATGTACAGGAAAGGCCAAGGAGA
AACAGGGCGAGTTTGATGAAAAAGACAATGCTTCCCCGCTGAAGCCTTTT
GTCTGGCTACATGTCTCAATACTTCGTGAATACTTGCAGGTAGAACTTCA
GGTTTCTGGTCAACCATTCAAGTTCGAGTTGGAGAGAGCTCTTGACGATT
GGATTTTTATGTGCTTTTTCGTCGGAAACGACTTTTTACCCCATTTGCCA
AGTTTGGAAATCAGAGAGAACGGAATCGACACTTTGATTGCCGTTTGGAA
AGACAATATCCCTCTTATGGGAGGTTACGTTACCAAAGATGGAACTGTAG
ATCTAAAAAGGGTTCAGTACATCCTTGATGGGTTGGCAAAGCAGGAAGAT
CAAATCTTCAGGAATCGGAAGAGAGTCGATGACAGAAGGGAACAAAACAA
CAAGAGAAGGAAATTGGAGGAGGACGCTAGAGCCGCTAGCGGACGCTGCG
GCGGCAATTTCGCTACCGGAGGGTTTGATTCGCCTTCTACTACCCCTACA
GGGAGAGGAAGGGGGCGGGGCGTTCCAAATTCTGCCCCTCCTCCTATGAT
CCCATTATTCAAGCCTGGCGATGTTTCAAAGGATACGAAGAAAATGAATT
ACGACATGGTAATCAATAGAGAAGGCATTCGAAAGGCTAATCTTCAGAAC
AAGAGCGCAGCTCAGGCCTTGAAAGCTCAATTATTGACTGGCTCTCCGAA
TGCCACTGCGGAATCTTCGCGTGACGGCTCTGAAATGGACATAACTCCTA
CCCCGGAGACAATTTCCACGACCGCCCCTGCCATATCCCACAAGAGAAAG
GCTGATATGGTTTGGGGAGACGAAACTCCCAAGACCCCCGGTTCCGAGTC
TGAGGCCGATGACCCTGATCGCGATCCTGTTCGTCTCTGGGAGCCCGGAT
ACCGTGAGCGATATTATGAGCAAAAGTTTCATGTCTCCCCGGACAATGTT
GAGTTCAGAAATAAAGTCGCTGCTAGCTATGTTGAAGGGCTTTGTTGGGT
GCTGCTCTATTACTTCCAAGGATGCCCTAGTTGGACTTGGTATTACCCAT
ACCACTATGCACCGTTTGCCCAAGATTTCAATGACGTAGGCAAGCTTGAT
ATCCAATTTAAGAAAGGGAAGCCTTTCAAACCGTTTGAACAACTGATGGG
TGTGCTGCCTGCCGCGAGTAAACACGCTCTTCCCGAGCCGTTTCAGAAAC
TTATGACAGAGGAAGACTCTGAGATCATTGACTTTTACCCCGAATCGTTC
CCCATTGACTTGAATGGAAAGAAGTTCGCCTGGCAGGGTGTAGCACTGTT
GCCATTCATCGATGAAAAGCGTTTGTTAGATGCTGTGTCAAAGGTCTATC
CCACGCTAACTCCTGAGGACGATGCGAGGAATG

Sequences in the Contig:

SY0AAA33YJ23FM1 SY0AAA48YB18FM1 SY0AAD3YN21FM1