Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig134
Length(NT) : 931
Best Gene Model Blast : Link to GSTUMT00004079001 E-value : 4e-27
Numbers of ESTs : 10

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig134
TTGGGGCGGTGGTAGCGCGGTGGTGGTGGGGGTTTCCCTTCATGTGGGAG
GGAGTGAATACTTTTCTGGATAGAGCTGTTGGGGCTCAGTCGGTATGACG
CAAGGCTGCTGGTTCGGACGATGGCCAACACAACACACGACGACGACGCA
TACACTCACCCACCACATGCTGAACCCCCCCGCTCTTTCTATCATCCACC
TTTACCCATCTTTTCTCTTCCTGTCGCCTCTTTCCCTCTGTCCTTCCTTC
CTTCTCTCACTCAACTCCTTCACTTCTTTTTTCCCGCTCTGTCTTATCTC
ACGCATACATGCTCCCCATACAACACCTGGAGCAAAACAACACTGAACAC
TTGTACTATTCGATTGGGTGGTTGCTTTCGATTTTTTCCCCATATACTTT
TTCTTTCTTCCGAGCTCAGTTGAGCGGTTGGTCTATGTGAGGTTATCGGT
CACGCGATTTCCTTTCCATTCCGATTCTTCTTAGTCAACGGAAGCCTCTT
TATTTGTTTGTTTTTTTGTTTGTTTAGCGTTGCAAATGTTTTAGCGATTG
GATCCCGTGATTTTTGACTTGATTTTTTAGCGAGCGCTGCTGTTTTTTTG
TCCTTTTAATTTGTTTATTACTCTTTTAGTCATCGCAGGCGGTTCTACTG
GATATTTTTTTCCCTCTTCTGTTCTTATTTTACTTGTTTATTGGGCGGCT
TTTTGTCTTTTTTTGCGCTTTCATCCCCATAAGACGGTCGCAGCAATGCC
GGAAAATACCAAAAATATTCCCATCATAACAGAACCCCCCCCATTTTACA
TATATTATATGAAAAGGGAAAAAAAAGAGAGAGGCTGAATTTTTTCTTTT
TCTTCTCCGCTCTCTTTTTTCTCCTGGAGTTTCGATTTCACCCTAACACT
TTTTCCTAACATTCCCCTCTTTCCTGTTTTA

Sequences in the Contig:

SY0AAA13YP07FM1 SY0AAA15YA09FM1 SY0AAA31YH08FM1
SY0AAB19YA01FM1 SY0AAB31YG19FM1 SY0AAB57YG07FM1
SY0AAB61YA14FM1 SY0AAD34YE24FM1 SY0AAD42YI05FM1
SY0AAD45YG06FM1