Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1339
Length(NT) : 780
Best Gene Model Blast : Link to GSTUMT00007446001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212504.1| Score: 621 E_value: 1e-67
KEGG Definition: metallo-beta-lactamase domain protein, putative
Accession: afm:AFUA_6G12940 Score: 626 E_value: 7e-67
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0813 Score: 346 E_value: 1e-33
PFAM Definition: Lactamase_B, Metallo-beta-lactamase superfamily..
Pfam Number: pfam00753 Score: 195 E_value: 5e-16
Swissprot: Q5XGR8|LACB2_XENLA

Sequence:
>Contig1339
TTGGCTTTTTCACGAACAGCAGCCCTCTTCGGTTCCAAACTACCCTACCG
AAAACTGCGATGGCGATTGCTCGTGGGCACAACGAGTACCTAGAAGCCCA
ACTAGCAACACTCCCGCACCTCCCCGCCGTCGAGCGGCTAACACCAAGAG
TAATTCGCATCCTGGGCGGGAACCCCTCAAAGTATTATACAGTACCACCT
CCAAGGCACAAACACCTACCTCCTTGGCACCGGTCGCGAACGTCTCCTGA
TAGACACAGGCCAGGGCATACCCATCTGGATAGAAACTCTCTCGGACGTG
CTGGCGCGCGAGAATGCCATCGTAACGCAAGCCCTCCTAACGCACTGGCA
CCTCGACCACGTAACCGGTTCCCGCGACCTCCGCAAGGTGAGCCCGAGCA
CAAGGTACTACAAGAACTCCCCGGACGACGGGCAGGAGGATATCCACGAT
GGTCAGGTATTCTCCGTCGAGGGTGCCAGCGTTCGAGCGCTGTATACGCC
CGGTCACTCCTTCGACCACATGTGCTTCCTCTTGGAGGAGGAGGACGCGA
TATTCACGGGCGATAACGTCCTGGGGCACGGGACGACGGTGTTCTCGGAC
CTCGGGGCTTACATGAAGAGTTTGCAGAGGATGCTGGATCAGGGTATGGC
GGGTGTCGCGTATCCCGGCCATGGCGCGCTGATTGGAGATGCCAGGGGGA
AGATTGCGGAGTATATCCGCCACCGGATGCGCAGGGAGGAGCAGATTGTC
AAGGTCTTGGAGGAGAAGAGGAATCCCGTA

Sequences in the Contig:

SY0AAA48YA19FM1 SY0AAB42YA20FM1 SY0AAC33YD15FM1
SY0AAD14YM03FM1 SY0AAD58YD22FM1