Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1338
Length(NT) : 1618
Best Gene Model Blast : Link to GSTUMT00006942001 E-value : 0.0
Numbers of ESTs : 177

Blast Results:

Nr Definition: DUF500 and SH3 domain protein
Accession: gb|EDP49359.1| Score: 559 E_value: 4e-55
KEGG Definition: DUF500 and SH3 domain protein
Accession: afm:AFUA_6G07880 Score: 551 E_value: 1e-54
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1843 Score: 367 E_value: 1e-35
PFAM Definition: DUF500, Family of unknown function (DUF500). Proteins in this family often also contain an SH3 domain (pfam00018), or a FYVE zinc finger (pfam01363)..
Pfam Number: pfam04366 Score: 355 E_value: 3e-34
Swissprot: Q9URW6|YIE2_SCHPO

Sequence:
>Contig1338
TTGGCCAACTTTTTTGTACAAAGTTGTCCCGGAATTGGCACAATTCGAAT
AATCATTACCACCATCTACAAACACTACTTACTTACCACCATTGCTATAT
CACCACTCTACACACCACACTCCATAAACAAATTTAAATGCCTGCACCAG
TATTTCAATACTTGTTCTTTCCAGAACTCAACTACTGTCCTTGCCCCCCG
AGAAAGTCGTTCTCTCCCCGCTTCGATGTGCGTGAGACCGCGAATGCGTA
CATCGTTGAAGGCGAACTGCCTGGCATTACCGATAGATCGAATATCTCCG
TCGAGTTCACGGGTAGGGGCAACATGGTTGTCAGAGGGCGGGTTGATCGG
TCGAGCACTATAGTCGCCCCCCAGGCACAACCACAAACATCGTCATCACC
ATCGCAGCAGACAAGCGGGAAGGAGGATAAGGGTGAAGATGTGGTCCCAA
CACCTACTTCCTCCGTGCCATCATCTCCATGATCACTGAAGCCGACGATC
GAAGACGTCCCGGACGAAGACGATTGGATGGGGATTACTGATTCGTCAAC
TGAGAAGGCGAGAGTTGAGGGAGAAGCTGCTAAGATGGGGAGCCCGGTTG
AGAGGAAGGAGCAGCCAAGGGGAAAGGTGGAGAAAGGAGAGGAATGGTCA
AAGAGGTTGTTGTCTGAGAGGTCGGTGGGGGGGTTTGCTAGAAGCTTCAG
CTTCCCGGCGGTCATTGATCACGATGCCGTGACTGCTTCCCTGCGGCATG
GAATCTTGAGGGTTGTCGTACCGAAGGTCTTTGGCGCTGGAAAGAGGATC
GAGATCCAGTAATTGGGAGAGTCTATGGATTGCTAGATGTTGTAGATTTT
ACTACTTGCGCCCTTGTACTGTACTTTACACGCTCTTTTGGTTGTTTCTT
GCCTAACTTTTTTGGTTTGATATTGCTTTCTCTAGTTCGCTCTGTTTGGG
GGTTGGAATACGGGATATTAGGGTAAATTTATATGTATTTTTACTGATCA
CAACTTGTACGTTTTTTGCCCCACGAAACAGAAAAAAAAAAAAAAAAAAA
ACCCAACTTTCTTGTACAAAGTTGTGCGGCCGGGGGACAACTTTGTACAA
AAAAGTTGGAAATGACTCGAACGCTGTCAAGACTTTCGCTCAGGTTGGTA
GCATCACGCTTGGAGGAAACGTATCCGTAGCTGCAGGTCCCGTAGGAAGA
AATGCGGAAGCTAGCGGTGCAGCAAGTTTAAGATCTATAGCCGGGATCTT
TTCCTATAGTAAAACCAAGGGCCTTTTCGCCGGCGTCTCGTTAGAGGGTT
CAGTGATTGTGGAACGAAAGGATGCCAACAAGAAGTTTTATGGGGGGAAC
GTCTCTGCTAAGCAGCTGCTCAGCGGCAGCATTGGCCCACCACATGACGC
GGACGCACTCATTCGGATTCTGAACTCCCGTGTATTCTCTGGAAACCTTA
CTGGTATGAACTATGACGATATGTATAATGATATTCCTACCTACGACAGT
GATAAAGACGAGTCTATTTGGGAGGGTCAGAGCGGCAATGCTTATGGTGA
AGGGACGAGACGGGGCTCAATAGGGAATCGCAACTTGTCCAGGTCTTCTA
CTTGGAAGGACGATCGGG

Sequences in the Contig:

SY0AAA12YG07FM1 SY0AAA13YA08FM1 SY0AAA13YN11FM1
SY0AAA14YG19FM1 SY0AAA15YI02FM1 SY0AAA15YO14FM1
SY0AAA16YD12FM1 SY0AAA17YN15FM1 SY0AAA18YF24FM1
SY0AAA18YG23FM1 SY0AAA18YI17FM1 SY0AAA18YI17RM1
SY0AAA18YO22RM1 SY0AAA19YO08FM1 SY0AAA19YO21FM1
SY0AAA1YJ14FM1 SY0AAA20YO10FM1 SY0AAA21YB07FM1
SY0AAA24YK04FM1 SY0AAA24YK04FM2 SY0AAA25YC11RM1
SY0AAA26YB03FM1 SY0AAA26YE15FM1 SY0AAA26YE16FM1
SY0AAA26YI16FM1 SY0AAA26YI16RM1 SY0AAA26YL12FM1
SY0AAA26YL12RM1 SY0AAA26YO04RM1 SY0AAA27YD06FM1
SY0AAA27YN21FM1 SY0AAA29YM08FM1 SY0AAA2YM17FM1
SY0AAA30YO21FM1 SY0AAA33YD01FM1 SY0AAA34YL22FM1
SY0AAA34YO22FM1 SY0AAA35YG03FM1 SY0AAA35YO14FM1
SY0AAA36YC09FM1 SY0AAA36YI20FM1 SY0AAA37YN09FM1
SY0AAA38YJ17FM1 SY0AAA38YO05FM1 SY0AAA40YC15FM1
SY0AAA40YN16FM1 SY0AAA41YA06FM1 SY0AAA41YG20FM1
SY0AAA44YD10FM1 SY0AAA44YM23FM1 SY0AAA44YN15FM1
SY0AAA44YP12FM1 SY0AAA46YK16FM1 SY0AAA47YO14FM1
SY0AAA47YP13FM1 SY0AAA48YF17FM1 SY0AAA50YM06FM1
SY0AAA52YD02FM1 SY0AAA52YH03FM1 SY0AAA52YN22FM1
SY0AAA53YJ18FM1 SY0AAA53YP16FM1 SY0AAA54YI10FM1
SY0AAA54YN01FM1 SY0AAA55YA24FM1 SY0AAA56YI18FM1
SY0AAA56YL23FM1 SY0AAA57YA03FM1 SY0AAA59YE08FM1
SY0AAA5YJ04FM1 SY0AAA60YB01FM1 SY0AAA60YB08FM1
SY0AAA60YB17FM1 SY0AAA62YH18FM1 SY0AAA62YI10FM1
SY0AAA63YG20FM1 SY0AAA63YJ11FM1 SY0AAA7YN05FM1
SY0AAA8YO06FM1 SY0AAB12YN02FM1 SY0AAB15YJ14FM1
SY0AAB16YI15FM1 SY0AAB17YH02FM1 SY0AAB18YM07FM1
SY0AAB18YP04FM1 SY0AAB19YE19FM1 SY0AAB19YI10FM1
SY0AAB19YI13FM1 SY0AAB20YF10FM1 SY0AAB22YC05FM1
SY0AAB23YP12FM1 SY0AAB24YK07FM1 SY0AAB25YL19FM1
SY0AAB26YA03FM1 SY0AAB26YL05FM1 SY0AAB2YB22FM1
SY0AAB2YH20FM1 SY0AAB30YO07FM1 SY0AAB31YI19FM1
SY0AAB31YJ10FM1 SY0AAB32YG03FM1 SY0AAB32YI03FM1
SY0AAB33YH20FM1 SY0AAB33YK21FM1 SY0AAB34YC02FM1
SY0AAB34YF10FM1 SY0AAB34YP18FM1 SY0AAB35YE04FM1
SY0AAB35YI05FM1 SY0AAB36YK07FM1 SY0AAB37YC13FM1
SY0AAB37YK07FM1 SY0AAB37YL04FM1 SY0AAB37YN12FM1
SY0AAB38YC04FM1 SY0AAB39YF21FM1 SY0AAB39YK21FM1
SY0AAB3YJ24FM1 SY0AAB40YC20FM1 SY0AAB40YF02FM1
SY0AAB40YK05FM1 SY0AAB41YG10FM1 SY0AAB41YI05FM1
SY0AAB42YF08FM1 SY0AAB43YA01FM1 SY0AAB43YG21FM1
SY0AAB44YA09FM1 SY0AAB44YE12FM1 SY0AAB45YA01FM1
SY0AAB46YI24FM1 SY0AAB47YB09FM1 SY0AAB47YC02FM1
SY0AAB47YC08FM1 SY0AAB47YI20FM1 SY0AAB47YM07FM1
SY0AAB48YH05FM1 SY0AAB48YL07FM1 SY0AAB48YN21FM1
SY0AAB49YA12FM1 SY0AAB49YA24FM1 SY0AAB49YB09FM1
SY0AAB49YN19FM1 SY0AAB51YK23FM1 SY0AAB51YO05FM1
SY0AAB52YG24FM1 SY0AAB52YI04FM1 SY0AAB53YF15FM1
SY0AAB53YJ09FM1 SY0AAB54YA02FM1 SY0AAB54YB22FM1
SY0AAB54YG18FM1 SY0AAB54YM08FM1 SY0AAB54YN12FM1
SY0AAB56YE07FM1 SY0AAB56YK21FM1 SY0AAB56YN04FM1
SY0AAB57YC17FM1 SY0AAB57YJ15FM1 SY0AAB57YM10FM1
SY0AAB57YN02FM1 SY0AAB58YC19FM1 SY0AAB58YF11FM1
SY0AAB59YE09FM1 SY0AAB59YI01FM1 SY0AAB5YG02FM1
SY0AAB60YB20FM1 SY0AAB60YG08FM1 SY0AAB60YH16FM1
SY0AAB61YG01FM1 SY0AAB7YI09FM1 SY0AAB7YN03FM1
SY0AAB7YP24FM1 SY0AAB8YI18FM1 SY0AAB9YI17FM1
SY0AAC27YM01FM1 SY0AAC32YM21FM1 SY0AAC32YM21RM1