Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1337
Length(NT) : 1044
Best Gene Model Blast : Link to GSTUMT00009247001 E-value : 2e-87
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1337
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCACAGAACGGACTTTGGTGA
AGGACAGGAAAAAAAATACCAGCTATCAAGAGAGAAAAAGCGAGCATACC
TCCTCCTCATACCGGCAATATCTCATTGCGCGCACAGCTTATCTGCCCAT
TCTCGACCTTACACAAAATCGAGCAGCTCCTCCATTCACCTTACAAAATT
TCCCGGTGGCGAAAGGTGGCAAACCTCCCTTTCTATTTTACTATTTAATA
CCGATATCCGCATATCCTTCTTAAAAAGTCCTCGTTCCATCATCCTTCCA
AACTCCTTCACCGGCTCAATCCAGAAGCTCAAAGCTTAGCCGTGCCCTTT
TCCTGCATACTGTCTCTCGGCAGTAAGTACTACGGAACAATCTTGCCCAC
CTACCCCTACGATCCCTTTGCTGATCGCTCCCAGAACATCCCTAAAGCCA
TCGCTCAAGTAGGAGCCATCCATTATCCACACCCGCACTATCAGGTCCCT
CCAGCGAAGCAAAAGCTCATCTATTGAACTTCCCATCGCAACCCCAACAG
CACACACAAAAATGAATTGGACCTGCTGCCAATGTGGCCGAAACTGCCAT
TGCACTACATGCGACTGCGGTCATAGTCTCTGCTTGAGCTGTGTGTATTC
TCGCCGACCAAAGCCTAAAGCATCGGGCACCCGCCGCTCACGATTGGCCT
CAATTCTCCGGAGGTGAAGCTAAGGCTACCATCACAACTTGACGACAACC
GATGTTTCAATTGCCAAGGATAAAAATGGAGAGAATTGGGCTATTGTACA
TACACAAGGGGTCGGAGGGACGCACAACACGAAGCTTACCGCTTGGTTTT
CGTTTTCTTTGCATATTGGAGTTGGTCTGGGGAAGCTCTTTTGTTCATTT
CTCAGGACTTGGCTATTTCGTTCCCCCTTTTTGTGTATATACCGATCTGG
CAGTCAATTGATTACCGAGCTCTCTATTTCAGCGCTATATATCTCTCTAC
TCAAACCCTTAGTTTGGAATGGCAAAACTACCTGAACGCCCTTC

Sequences in the Contig:

SY0AAA47YO03FM1 SY0AAB47YM14FM1 SY0AAC31YO07FM1
SY0AAD18YM04FM1 SY0AAD28YB13FM1 SY0AAD57YP12FM1