Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1336
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00003239001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_10857
Accession: ref|XP_001550384.1| Score: 255 E_value: 1e-20
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G10250 Score: 234 E_value: 2e-18
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4274 Score: 119 E_value: 3e-07
PFAM Definition: No Hit Found
Swissprot: Q5U2U6|LITFL_RAT

Sequence:
>Contig1336
TTGGGTCACCGCCAACAAACCCGTCCAAGAGCAAAAAGGGCAAACAAAAT
GGGCATAACCAAAATGGGCATAACCAAAATGGCAAGTGACCTTCCACCTC
CAGCATCCGGTGAGATCCAACCGGACCCAAAGTACCCTCCTCCCAAGGGC
ACCGCGCCTCCCGAAGAACCCCCCATAGCATCCGAACCACCAAAGCCGCA
ACCACAACAACCGCAACAACCGCAGCAGCATCAACCACAGGCCCCGGTAA
CTGGCGGCGCCCCGGGACTCTACATAAACACGGTGCCCCTTCAATCGCTG
ACGCGCTCCCCGGCGCCGGTCCAGTGCCCGGTATGCAACGCACGTGGGTT
GACCGTGGTTACCTACGAGATCGGAAACACAACGCATCTGGCCGCACTCC
TCCTCTGTTTCGTGACGAGTCTGGGGTGCATCCCGTACATGTTCAATGCG
TTTAAGGACGTTGCACACAGTTGTGCGAGTTGCAGGACTATGCTTGCTGT
CTGGCATCGGAGTGGGTCGCCGGGCGCTGTGGAGGTGCTTGTTCACCCGA
TGGCGTCTGTGCAGCAGGTGCCTGTGAAGGGAGGGGTCAAGTAGAACTCA
CTAATGCGGGGTGGTCGTTTTGATGTTCGCTTTTCGTTCT

Sequences in the Contig:

SY0AAA28YE03FM1 SY0AAA47YN17FM1 SY0AAA6YN06FM1
SY0AAB60YC09FM1