Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1335
Length(NT) : 715
Best Gene Model Blast : Link to GSTUMT00006156001 E-value : 1e-118
Numbers of ESTs : 2

Blast Results:

Nr Definition: nucleoside transporter, putative
Accession: ref|XP_001274294.1| Score: 530 E_value: 2e-52
KEGG Definition: permeases; K06901 putative MFS transporter, AGZA family, xanthine/uracil permease
Accession: aor:AO090010000333 Score: 511 E_value: 2e-50
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O94300|YOOH_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>Contig1335
TTGGATCTTATCTACGGGCACGGTGGTAGGGAAGTTTTGAGATCCCAAAC
GGAAATAAAGGCCGGCGAGTCCATCATACTAAAAAAAAATTCCATTCTGA
ATTGGGATAACTTGCTCTAGTCCCCGTCCTTTTTTCCCTCTCACTCTTAC
TCTGCTGTGCTTCTATCCTCCCCTTCACCTTCAGACTCGGTTTACAGAAG
AGAGTGTGTGAGAGGGAGAGGGTGAAGAAGAGATCTGATTTAAACTCGAT
CTCCCAAAATGACTTGGATCGATCGGACAAACAGACGGGTGGCCGACAGT
TCATTCGGTCGATACTTTCGACTAGAACATTCTGGTCACAGGAAGGAGCG
AAAGGGCTCACGATTCTTTACGGAGATTCGTGCTGGTCTTGCTACTTTCT
TTGCAATGGCCTATATAATTGCTGTAAATGCGAATATCACATCGCAATCC
GGCGGAACCTGTGTCTGCACACCAACGCAAGAGGACCCGGTATGCGACAA
GAGCGAAGAATACATGCTATGCGTGGGCATTGTGCAACGAGATCTGGTAA
CCGCAACTGCCGCCATCGCCGCCCTGACATCCTTCTTCATGGGACTCGGA
GCGAACATCCCCATCGCATGCGCGCCCGGTATGGGACTTAACGCCTACTT
TGCATACCAAGTCGTTGGATACCATGGCTCGGGGCCGGTGCCCTACAGGC
TCGCTGTGACGGCGG

Sequences in the Contig:

SY0AAA42YF06FM1 SY0AAA47YN10FM1