Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1334
Length(NT) : 791
Best Gene Model Blast : Link to GSTUMT00005895001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_01519
Accession: ref|XP_363593.1| Score: 323 E_value: 3e-28
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01519 Score: 323 E_value: 1e-28
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1855 Score: 191 E_value: 1e-15
PFAM Definition: La, La domain. This presumed domain is found at the N-terminus of La RNA-binding proteins as well as other proteins. The function of this region is uncertain..
Pfam Number: pfam05383 Score: 179 E_value: 4e-14
Swissprot: P87058|LAH1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0031137 = Biological process: regulation of conjugation with cellular fusion
GO:0042173 = Biological process: regulation of sporulation
GO:0042779 = Biological process: removal of tRNA 3'-trailer sequence
GO:0006386 = Biological process: termination of RNA polymerase III transcription

Sequence:
>Contig1334
TTGGCCCATACCGGTATTTTCTCTTCCCCATCCAAACTCCACCCAACCTC
TATCATTCACCCCCAATCTTTCTAACACTGTTCTCAAGCCCTGTTAATTT
TCTCCCGCTATTTTCTCATTACTTTCTCGGAAGGGGAAAAATGGGTGACG
AGGTTGCTACCGATATGGCGACAGAGGTTCCCAATCTAGGGGAGAATGTC
GTTGAGCCGACTGTCGAGAAGGGCGAAGGAGTCAAGGTTGTGGAGCAGCC
AGCGGCTCCTGAGGTTGGAGTGAAGCAGGGAGAGCCCGTGGAAGAGAATC
TTGTCGAGGATGCCGTTGAGTCGGCTGTCGAGAAGGACGAACAAGTTAAG
GCCGAATCTTTGGAGCAGCTAGAGGATGTAAAAAGCGCCACTGTTGAGGA
AAAGGACAGCACGACGGCGGAGACTAAGGAACCACCCAAGTTGCAGAAGA
AAAGTGAAAACATCAAATTTGATGCAACTCTTCTCCCGGAATCTGACGAC
CCAGCGGAGATTAGGAAGCAGGTCGAGTTTTATTTTTCAGATTCCAACCT
CCCCTTTGACAAATTTCTCTTCGGCCTCGTTGGTAAAGATAACCGCTCAG
TCCCTCTTAAGCTTATCCGCTCCTTCAAACGCATGCGCCGCTTCACAAAC
CCAGAGGCCATCGTCAAAGCGTTGCGTGAGAGCGAAGCATTAGTCATCAC
TGGTGATATCGGAGAAGAGACCATTCGGCGGAAGATTCCATTGATCATCA
ACGAGGTTGAAAACAAGGAGGGTAACGTAGAGAGCAAAGAT

Sequences in the Contig:

SY0AAA47YM23FM1 SY0AAA49YE23FM1 SY0AAA55YG20FM1
SY0AAB60YD01FM1 SY0AAC62YN20FM1