Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1333
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00004230001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1333
TTGGTTCACGGCTACCATTGCTAGATAAACCGCACAATATACCAGCAACA
CCCTGGGTATATATTTGCCTTCTTCCTTCGCAAATCCCCCAACATAACTA
CTACAAGCACGCACGAAGAAAACTGCGAACTCGCCAAAAATGCCTTACAG
AGCCGACTTCAGGCGCGGACCCAGGGGGAATGGTAAATGGGCTCGGAACT
CGCTCGACCGCGTGCGTTGCGAGGCGAGGTACCTTTACGATCAGGTCGAT
CGTGATGTCCAGTGGGAATGGAGCGAGGGAGGTTTGGCGGCTAGCGACGC
TGAGTTGTATCGGCTGGGGATACTATATGATCAGGAGGTAGAGGAGGTTG
AAGTCGCTTCCTGTGTTGGGGAGGAGGTTGGCGCTAGGAGTGAGGCCGGT
GATGACTGGTCGGTGCTGGATGATGGGGAGTCGGTGATTGGGGATTGGGA
TCTTATTAGCGAGTTGGGTTAAAGGGTTGAACCCCTTCAGCCTTTTCTCT
CCTGCTTGCTGTAGTATATCTCGGTCTCTGGTTTCTGGCGTTTGGTTTTT
TTTTAGGCCCTATTGTATTGTAGCGTTTTTGGATACTTAGAGTTGGGTGG
CTTTTTGGCGAGCTACTTTCTCTTCGAGGAGAGCATCCGATTGTCGGCAT
AATATTGGGGCTTTGGTTAACCCTTTTTTTCAACCAACATTTTGTTTTT

Sequences in the Contig:

SY0AAA30YE04FM1 SY0AAA30YE04RM1 SY0AAA32YB18FM1
SY0AAA41YI09FM1 SY0AAA47YM14FM1 SY0AAA63YF06FM1
SY0AAA63YL09FM1 SY0AAB13YI18FM1 SY0AAB22YG15FM1
SY0AAB2YH11FM1 SY0AAB33YD07FM1 SY0AAB42YG21FM1
SY0AAB45YH08FM1 SY0AAB46YO17FM1 SY0AAB47YM06FM1
SY0AAB53YD21FM1 SY0AAB56YA12FM1 SY0AAB60YN16FM1
SY0AAB6YF21FM1