Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1332
Length(NT) : 1003
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1332
TTGGGAACCCATCCCAGCCCAAGGGCCTCGACGATATCATCATTTTCTTG
CTTTTCTTCTTCTTTTTTTTTTCTTCCCCACATGCGGGTTTTGGCTATCT
GGACGGTGCGTGTGGTGTTAACTAGCGCGAATCAAGTAAGTTTAGTTAAT
TGCGGTATGGATAGACAGGATATTTCCCGAAGCAACTCGTACATTATGAT
GCAGCGGTTGGATGCCACCACCACCACCACCACCAGGGTGACGGCAGCAG
CAAAGCAAGGACTGGATGGCAAGAATCATGCACGTTGGGAAGAAAAAATA
TATGCAGTATTACTGCTATTATTATTATGGTGAGGAGGAGGAGGGCGGAC
ATATAATACGACCTCTCACATTCTCCTCAACAGACATAGGATTGCAGTAT
CGTACCGGTATTTTCCCACGACAAGGACAAGGACCTTACGCTGTTACATA
CCATACCGGTACAGTACTCGAGTACAGTAGCGCTTTCGCACGGTCTCCGA
AAAGTATAAAATATTTTATCATATCCGCACGATAGTTTTTTGCTCGCTTC
TCATGCTGCGAGCGGAGGTCAATATTGTCACGGTAGCTGCTTGCTTTTTT
CTTTACTTCCCCTCAGAGGAGGATAAGTCTAGCCAAGTCACTTGTCTCCT
TCGCCCTACACACCATTTCCTTTTTTTCTTTCTAGTATTTTTACTTTTAT
CCTTTGTGAGGCTGGGCTGGGCTAGTCTGGTCTGCTCAGGGTGATGGACC
GTCATATCTAGCTGCAGGGCAATCTGGCAGTTTAACTACACCATCAAAGG
GAACCATTGAATGAAAAAAAAAAAATCCTCACTTGTCCCCCCTCCTCCAA
TTTCCATCTTTTTGCCTTCCTGTGGTGTGCTTTAGTATACCTTCACTGCT
ACCCCACGGGGTTCGTCCACTTGTCTCCTAGTAATTCGAGACCAGTGTAA
CTCGACATTCGCATGGACGTTAGCTCCCAGAAGGGGAAACCTTATCTATT
CTC

Sequences in the Contig:

SY0AAA47YM03FM1 SY0AAB24YG12FM1