Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1331
Length(NT) : 1044
Best Gene Model Blast : Link to GSTUMT00003737001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein An08g03040
Accession: ref|XP_001392421.1| Score: 407 E_value: 8e-38
KEGG Definition: hypothetical protein
Accession: ang:An08g03040 Score: 407 E_value: 4e-38
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4781 Score: 162 E_value: 5e-12
PFAM Definition: No Hit Found

Sequence:
>Contig1331
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAGGTAGGCACCCAATAT
TTTCCATCCCACACCTGTTTTGTTTTTTTCCCTCAAAGGCAATCCTAGGG
TCCAGGAACCAATCTTTCCCCTCCTAGGTTTTCAGGAACGTTTCCAAGAG
TTTAACCCTCTTCCTTCCTTCTCTCTTCGGGGAAGCTGACAGGCATTGTT
CGATTGTTGGGAACTTTTTCCCCAAACCCCCATTGGCATCAACCTCGGTG
GAATTACGAATCACCGAAGGAAAAACATTCACCTGTTCCGCCGCGTTTGC
TCGACTCCGGCCTCCGGCCTCCGGGTGTTGACGTTACCGGTAGCATTGGT
ATAGGTGTGGTTTTCCCGAGAAGGGAGAAAGGGAAGGGAAGGGAAAGGAG
ATGGTTATATTGAATAGATCTCCTGCTCTGGCGGGCAGGGTGTTGAGACA
TTCTACACCGTTAATTTCACCTCTGCGCTACTTTCCTACTGCTGCCGCCA
TTGCTACTCCTGCATCACGGTTTGCTACTACTAAGTCTTTTGAGCCTATT
GGGAAATCTGCTTATCAAAAGTTCTCGGATAAAATCAAAGAAGCAACATT
TATACGTCCCAGCATCTGGTTGCTCTCAGGCGTTACTATAACTATCCTCA
CAACCTGCAGCTACATAATGGCTGCACAGGGGTATATCGCCCTCACAGAT
GAGGAGACCCTCCAAGCATACACACCCACGGACCCCCAAGAGATAGAAGC
AAACAACTACATCTCCAACCACCCACTTGTCACCTCCTTACGATCAAACC
CCGCCTTCAGCGAAACCCGACCGACGCTGAAAATCGCGGATAAGTATAAA
CACCTTTCCTTCACCGCAGGCACTCTCGCAGGCCCAGGAAAGATTGTAGT
CCCACCACTCACCTTCGTAGAAGACGGCGGAAAGAGCATGGTGCAGGTGT
TCTACCTAGGTGAACAACTGTGCGGACATCCAGGGTACATTCACGGCGGT
ATGCTCGCAACCATACTAGACGAAGGGCTCGCGAGATGTTGCTT

Sequences in the Contig:

SY0AAA47YL21FM1 SY0AAB12YF17FM1 SY0AAB18YE03FM1
SY0AAC1YA03FM1 SY0AAC4YD04FM1 SY0AAD39YJ10FM1