Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1330
Length(NT) : 2282
Best Gene Model Blast : Link to GSTUMT00002175001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein FG00573.1
Accession: ref|XP_380749.1| Score: 977 E_value: 1e-103
KEGG Definition: hypothetical protein
Accession: fgr:FG00573.1 Score: 977 E_value: 1e-104
KOG Definition: No Hit Found
PFAM Definition: Fungal_trans, Fungal specific transcription factor domain..
Pfam Number: pfam04082 Score: 218 E_value: 4e-18
Swissprot: P49413|UAY_EMENI

Sequence:
>Contig1330
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCGGGGAAACGAGGGGAAGTGACCTAGGGAAGGGAGGAAGAGGG
AAAGAGGGAAGATATGAGCAACTCCGCGTCTGATTTGAGTGCTCCACTTT
TGAGAGTTAGCAGACCTGTTAGTGCCTGCTCACGATGCAGGAGCGCCAAA
GTCAAATGTGATGGAAAACTCCCCGCTTGCACTGCGTGCGAAAAGTCCGG
AAAAGCCAACGAATGTACCGGCGGTAGTGACCAGTTTGCTCGCGGGAAGG
AGAGGAGCTATATTGCATGGCTAGAGTCAAAGGTGGAGAAGCTGGAGAAG
GAACTTGCTACTCTGGAGAGCCGCAAAGCTCCCTCTGGGTCGATGGGTGG
TAATGGGGCTGGTGGTGGCGACTCCCGCTTGACGCACCCGCAGCAGGATC
TTAGAAGAGATCGACGGATTGCAACGCCTGGGTCGCCGCTGCCGAATGGG
GCGAGAGCTAAGACGAAAAAAAGGGAGGAGGCGAATGAGATTGAAGATCT
GGTTGCTGATTTGGGATATATGGCTATCAATGCTACGACTCGAGATTTTT
ATGGATTTGCGAGAGATATGACCTTTGCAAAGGTCGTGCTAAAGGCGTCA
ACCGCTTCGAAGGCTCTCGAGTCAAAGCCTCGGGCGAGACTTCCTCCACG
TCACACCGCGACACAATTGATACAGCACTACTTCGACAGGATATTCACCA
CACTTCCGTGTCTGAACGAGGCTAGTTTCTTCGGCGCTGTGGACTCGGTG
TATCGCGATGAATCGACGTGCTCTCCCTACGATATTTACACGGTTTACAT
GGTGCTTGCTATCGGGACGATGTCACTGTCAAAAAGCAGGGACTCCCCGG
CAGCACATAATGCGGCGTGCTTTGTAAAATCTGCGCTTGAGCATGCGGAT
GCCGTGATTTCTCCTAGTGCTATCACCGGTGTTCAGGCTGCCCTGCTCCT
GGTGCAGTACTCTATGCTAGAACCTGCGCATTTTAATAGTTGGTATTTGA
TTGGGATTGCATCACGGATAATGGTGGATTTGGGGCTTCATCAGGAGCCA
ACAAAAAGCCTGAGGAAGAAGTCGGCTGACATGGACTTGAGAAGGAGAAT
TTTCTATTGTGTGTATACTTTGGACAGGTCGATCAGTATGGCTCTGCAAC
GACCATTTACATTCTCGGACGACTCAGTATTAGTCGACCTCCCAAAACTT
GAGGACCCAAAGGTAGCAAAGCAGATAATAGTCCGGGGAACATTAACGCC
TATGGCTGCCGCGATACATCTTTTTCGTCTCCGCAAACTGCAATCAGAGT
GGTATCAATTCCTGCACCTCTCGGGCTCGGAGCCCGTTCAAGATTCAATG
GCCTACTTCCGCAGCAAAACTGCGATCCTGAAGGAATGGCTAGGCAAAAT
TCCAGAGTCAATAAACAACTCCACACGCGACTGGCTGTATTTAGAATGGT
ACTACCTAAATGTCTACACCGCAGCACCGTGTCCCAAGATTCCAAGACCT
TGTGACGAAGCCATAGTCCAAGTCTTCCAGAACTGCGTAAACTACGCGCT
CATGTTCCGCAGTATCCTCCAAAACTCGAATGTCCGTTTTGTATACACGT
ACCACGACGCACTCCGAACATATTTTATTGGGAACAACTTCCTCCACGCA
CTCTGGCGCTCGGAGGACACCATTATCACAAGCGCGAATGTGACATCAAC
CATTGACGCCATCAAAGCCATCATATTCGTCCTCACTTCTATGATTGTGC
GCTGGCAGGAGGTTGAAGCCCTAAGAGATAAATTCCGCGGGGAATCGAGT
TACATGTTGGGGAACCTGGAGGCACGGCAGCAAACCCTATTGGTGCCACC
TAGGCCCCGGGTTACGAGGGAGGAGGCGGAGAGGGTGCTTAGGCATCAAC
TGAGCATTGAGTGGGGGGAGATTGACAGCTTCAACCCGCAGCTGTATAAT
CCGTCGGGGCATATTGCCATGGCGGATTTTGGAAATGTGGCGTTTTATCG
GTATGCCTAAGTGCATCACGTAGTTGGTGGTTTAGCGGGAGGGAAGACAA
GTAGGAGAGGGAGGAACCACGAACATCTGCATGGCGTAGTATTAGGGGTT
ATTTATTTCGAGTTGTTTTCTGTTTCTTTCATGATGCAACGATTTTTACA
GTAGTCTTTGAAATCATTTGATTCTTGATTTTACCTGGTGGGTTTTTTTG
AATAAAATTTGTGTCCTTGATTTCAAAAGGGG

Sequences in the Contig:

SY0AAA38YC16FM1 SY0AAA42YO08FM1 SY0AAA46YG07FM1
SY0AAA47YL20FM1 SY0AAB53YN07FM1 SY0AAB9YB24FM1
SY0AAC1YL09FM1 SY0AAC29YP05FM1 SY0AAC34YE24FM1
SY0AAC44YP16FM1 SY0AAC5YM24FM1 SY0AAD23YB02FM1
SY0AAD24YI20FM1