Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig133
Length(NT) : 776
Best Gene Model Blast : Link to GSTUMT00010219001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: peroxisomal membrane protein Pex17, putative
Accession: ref|XP_001260349.1| Score: 390 E_value: 5e-36
KEGG Definition: peroxisomal membrane protein Pex17, putative
Accession: afm:AFUA_2G08410 Score: 371 E_value: 4e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig133
TTGGCGCCCAAAAGCCACCGCAAAGGAGTCTACTCTTCGACCCCCAAACC
CAATAATGGTAGTCGACCGCCGTTTAGACAATATACTCCGAATTCTACTT
CAGCCCGGAGCGGCAGATCCGAACAATGCCGACGCATCTAGTGTCTACGC
CTCGGCCGCAACGGTTCTCGCAACGTTAACAAACCCGCTGAACGTCTCTC
TACTATCCACCCAAATCCTGATCTCCCCTGCGATATGGGAAGAGAACTTC
GATGGGCTCAAAGCCGGGCTACGTGTCTTTGGAGTCTTCCAGAGTGCTAC
GGTTGGAAAGTTCGAGACACAGGGGTCTATTCTGAGTGTTGAAGAATGGA
TTAGTGCCCTCGTTAGGGGGGCTAATAATAACGTGCCTCGGTGGAAACAT
CTTTTGCTTCTCGGGGGTGTACTTTCGGCGGATCAGGAACGGTCGCAGCT
GCCCAGGGTTACCCGTACAAGTCTCGAGCAGGCGTTTTGTAGGGCGGTGA
ACCTATCAGTGGAGAGCAATGCTCGTCACGAGCTTGAGGCGGACGTTCTC
AGTCTTGTTTTATCACATGCTATTCAATGCCTTTCAAGGAGAGCAAAAGA
GGCTATCCACTACGATGCCCTGTTACCCGTGATTGTGAAATCTATGTATA
ATTCCCGTGAAGGGTTTCAATCAGGGTATTTCCTTTCAACAATTGATCAC
GATATAATGACCATCGAGGGAAAACTTGTCTGGCCCAGTAAATCGAATTC
CTTCCTGGAGCTTCAACAGAGGTCTG

Sequences in the Contig:

SY0AAA14YP07FM1 SY0AAA29YB05FM1 SY0AAD10YF08FM1
SY0AAD40YB20FM1 SY0AAD45YJ11FM1 SY0AAD59YK09FM1
SY0AAD60YB20FM1 SY0AAD9YE04FM1