Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1329
Length(NT) : 787
Best Gene Model Blast : Link to GSTUMT00001599001 E-value : 6e-81
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1329
TTGGCTTTCTACATCTCCGCTGTCAAATGCCATTTTGACCGGCTCGCGTT
TACCCTCTTCCTCTTCCACGCAGTCTCTCCACCAAGTCTTCGTCGTGTCC
GTTCTCCTCTCAAACTTTGCACTTACCCGTCGGTTTTGTGGTCGCCTTCA
CCTTTTTTTCTCTTCCAAAACTGCTCTCTCCCTCTCTTTCTCCATTCTTC
CCCCTTCCCTTCGATCAAGCTCCTCCCCCACTTTTTCACATACTCGCTCC
CTTTCTTTAGACACATTTTCCTAGTTCAGTCCCGAGTTCGCGATTTAAAA
AAAATTTACCCTTACTTTACGCCCAACTCATCTCTTTCCTTCCAACAGCT
CCCTCTCCCCGTTACCTCACCGTCACCATCTGCTATCGACGCTCGTTGTC
GTCAGCCACACGGAAACCCTGCTCCCCAGCGTTTTTTTGTCAACCCTCAA
CCATCATCCCCCCATTCATAATTAGTCCCTTTGCACGTTAAATATTTCAG
TCTCCCACCACCTCGTTGCCCATATCAATAATACCTCTTCCTTCCACTCA
CGACCACGACCACTGCCACACTCCAACCGACAAGCGATATCCGGCGAACG
ACCACTGCGGTCGATATAAAGCAGTACCCCTTCAAAATGGTGTTCAACGA
CTCTAATCCTTCGTTCAGCATCTCCAGCATCCTAAGTCGCTACGACTCCT
CTGCCACCGCCACCACGCCATCCACAATCTCCAAACCGCTTCCTACGAAG
AAACTGGTTAATAATGCAAGGCCAAATGGTACTGGCT

Sequences in the Contig:

SY0AAA23YG08FM1 SY0AAA47YL01FM1 SY0AAA55YC15FM1