Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1328
Length(NT) : 766
Best Gene Model Blast : Link to GSTUMT00002627001 E-value : 1e-60
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001214566.1| Score: 181 E_value: 8e-12
KEGG Definition: 50s ribosomal protein l36
Accession: cne:CNK03080 Score: 180 E_value: 5e-12
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4122 Score: 175 E_value: 1e-13
PFAM Definition: Ribosomal_L36, Ribosomal protein L36..
Pfam Number: pfam00444 Score: 162 E_value: 3e-12
Swissprot: Q035A6|RL36_LACC3
Gene Ontology:
GO:0006412 = Biological process: translation

Sequence:
>Contig1328
TTGGGCTTCATTGGCCTATGCCAATTCTTCCCCACCATCTTACCGCAGAC
CTTACGATAACCGACAATAGTCTGCACCCAAGCCTCAGAACGTCGCCAAC
GAACCAACCCAAACCCTTCCCTCTCTCATCGTACTCCTCCCCACCCCAGC
AAGTACTCACCTCCGCCTCGCTCTCACCCGTCCACATTCACTCCCTAAAT
GCCGGCTGTCAACCTTTGGAGAACCCCCTGGACTCGTCTTGCCCTCTATC
GACAATCTTACATCATGGTCTATTCCTTCTCATCACCATCCACAATTCCA
AAAAATCTGCCCCGCTCCACAAGCAGGCAGCCCTTCTCGACCTTGCTAAC
TCTGTCTCTCACCTTTCGGCCTCTCGTTTCAAACACAAACATCACACCTC
TAATTGTCCACCACTCTTGGAACACGGTTTCCCACAATCACAATCACAAT
CAAGTATGTGGAATGAAGGTGCGATCGGCAGTCAAAAAATTGTGCGAGTG
CTGCAAGTCGGTCCGCAGAAAGGGCAGAGTCTACATCATTTGTAGCAAAA
ATCCCAAACATAAACAACGGCAGGGTTAGATCCAATATCCAGGTCATGCT
AGATTTAGGGGGGGTGATCGGTGATCGGTGCATGGAGTCAGTCCCGCCTG
AGTCATTGCGTGTGGCCAGTGGCCCGACTTGAAGTGTTCGTACAGGGAAA
TGGGAGTATGTCAGCGTCTTCTTTTTCGCCATTATTCTGCTTCTACCATT
TAATCTCATCTATCAC

Sequences in the Contig:

SY0AAA16YO03FM1 SY0AAA47YK21FM1 SY0AAB51YM19FM1