Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1327
Length(NT) : 709
Best Gene Model Blast : Link to GSTUMT00003999001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_02695
Accession: ref|XP_366619.1| Score: 455 E_value: 1e-43
KEGG Definition: hypothetical protein
Accession: mgr:MGG_02695 Score: 455 E_value: 6e-44
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG4128 Score: 429 E_value: 3e-43
PFAM Definition: Peptidase_C1_2, Peptidase C1-like family. This family is closely related to the Peptidase_C1 family pfam00112, containing several prokaryotic and eukaryotic aminopeptidases and bleomycin hydrolases..
Pfam Number: pfam03051 Score: 498 E_value: 3e-51
Swissprot: P70645|BLMH_RAT
Gene Ontology:
GO:0008423 = Molecular function: bleomycin hydrolase activity

Sequence:
>Contig1327
TTGGGCATTTCCAAAGTGAACATAACCCCGAGGTGAACACACCTTGCACC
GTACCTCGCCGCTACCTTGGTACATACATGCTAAAGGACTCCACCCGCTC
ACATAGATAAGAAATAGAATGGGGTCGTCGTCATCTAAGCCTGCCCGTCC
CACATGGCCTGCTGTGGAGAAGCCTCGGAGACCGGCTCTCGAATCAAAGA
TGAGCGACCTCACTTTGTGCGATACAGACTCTAGCGAGGAACCGGAGCCT
TCTCTTTCCTTGAGGCTCGAAGCCGCTATCAAGTGGGAAGCCAAACTCTT
GTCCGAACCAAAGAATCGTCTTGCTCTTGCTGCTCTTAGCACACACGCTT
CTACAGCCATCCTTCAAAAGCCGTCGGCGCTCCTCCACGATACCCATGTG
TTCAGTGACCAGATTGAACTCGAAGGAACCCCCGTTACCAACCAGCGCTC
CTCAGGGAGATGCTGGCTGTTTGCCAGCACCAACGTCTTTCGAGTTCCGA
TAATTAAGAAATACAAACTGACTGGATTTGAGCTGTCCCAAAATTACCTC
TTTTTCTGGGATAAACTTGAGAAAGCCAACTTTTTCTTGGAGCAAATTAT
TAATACCCAAGAAGCAGATCTCGATGGAAGGCTGATTCAGTACCTACTGC
AATCTCCTGTTGGTGATGGCGGCCAATGGGATATGGCTGTAAATTTAGTT
GAAAAATAT

Sequences in the Contig:

SY0AAA42YP12FM1 SY0AAA47YK16FM1 SY0AAA50YC20FM1
SY0AAB38YP16FM1 SY0AAC46YF21FM1