Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1326
Length(NT) : 711
Best Gene Model Blast : Link to GSTUMT00006625001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: glutathione S-transferase, putative
Accession: ref|XP_001273386.1| Score: 557 E_value: 2e-55
KEGG Definition: hypothetical protein
Accession: ang:An07g02310 Score: 542 E_value: 5e-54
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0867 Score: 372 E_value: 1e-36
PFAM Definition: GST_C, Glutathione S-transferase, C-terminal domain. GST conjugates reduced glutathione to a variety of targets including S-crystallin from squid, the eukaryotic elongation factor 1-gamma, the HSP26 family of stress-related proteins and auxin-regulated proteins in plants. Stringent starvation proteins in E. coli are also included in the alignment but are not known to have GST activity. The glutathione molecule binds in a cleft between N and C-terminal domains. The catalytically important residues are proposed to reside in the N-terminal domain. In plants, GSTs are encoded by a large gene family (48 GST genes in Arabidopsis) and can be divided into the phi, tau, theta, zeta, and lambda classes..
Pfam Number: pfam00043 Score: 146 E_value: 2e-10
Swissprot: O59827|GST2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004364 = Molecular function: glutathione transferase activity
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0042803 = Molecular function: protein homodimerization activity
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>Contig1326
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGACACTCCAAGTCCCCTT
CCCAATTCCAAACTCCCACAACCCGCACAAAAAATTCACAAAATGTCTCC
TCCCAGCATAACCCTCTACTCCCACAGGGCCGGTCCTAATCCGTGGAAGG
TCGACATCGTTCTCCGCCACTTGAACATCCCCTTCGAAACCGTCTTCATA
GGGATCAACGGCGAGCACAAGCGCCCCCCATACACCAACATCAACCCGAA
CGGCCGCGTACCCTCACTCATCGACCACTCCAACAACGACTTCACCATCT
GGGAGTCCGGCGCGATAATGCAGTACATCGTGCAGAAGTACGACAAGGAA
CACAAACTGCTCTTCGATAACTTCGAGGACAACATGCACGTGGAGCAGTG
GTTGATGTTCCAGATGAGCGGCCAAGGACCGTATTATGGACAGGCAGCCT
GGTTCACTCGCTATCATCCTGAGAAGGTCCCGAGCGCGATTGACCGCTAT
GTGAAGGAGATAAAGAGGGTTCTTGGCGTCCTCGACGCTTGGCTTGCGGA
TAAGGAGTATCTCGTCGGTGGGAGGTTGTCTATCGCGGATATCGCGTTTG
TTCCGTGGCACGAGGCGTTGGGCTTTTTGGATAATGAGGAGGTGAATAAT
TGGAAGAAGGAATTCCCCAATGCTGCGGCTTGGCACGAGAGAGTTATGGC
GTTGCCGGCTG

Sequences in the Contig:

SY0AAA47YJ13FM1 SY0AAA58YD08FM1 SY0AAB13YI14FM1
SY0AAB23YA05FM1 SY0AAB51YL02FM1 SY0AAB54YB07FM1