Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1324
Length(NT) : 1195
Best Gene Model Blast : Link to GSTUMT00011031001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein An18g05140
Accession: ref|XP_001398968.1| Score: 895 E_value: 3e-94
KEGG Definition: hypothetical protein
Accession: ang:An18g05140 Score: 895 E_value: 1e-94
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2963 Score: 792 E_value: 6e-85
PFAM Definition: Brix, Brix domain..
Pfam Number: pfam04427 Score: 278 E_value: 2e-25
Swissprot: O14206|YDD3_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus

Sequence:
>Contig1324
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCACCACCAACCGCCACCCA
CCTACTATCAAACACAGAATGGCTCGCCGTCGTACAAAGAAAAGAACTCA
TATCACGCCAGTAGATCCCACCAAGAGTGCAACAGTTGGAGGTCAGCCTC
TCAATGCTTCCGCCTCGCGTACACCCAAGACGATGGTCATAAGGGTGGGT
GCAAGTGAGGTCGGTCCGAGCATTAGCGAACTGGTTCGGGACGTACGGGC
AATGATGGAACCGTATACCGCCTCACGTCTACGGGAGCGTAAGTCAAACA
AGTTGAAGGACTACACCACGATGGCTGGTCCCCTTGGCGTCACTCAACTT
CTTCTCTTTTCCCGTAACGCTGGATCGGGGTCTGCCACTCTACGAATTGC
GCGCTGTCCGCGGGGACCTACCATTCATTTCCGTGTGAAAAACTACTCGC
TTTGCAGAGATATTAGGAAAAGCATGAGGAACCCGAAGACTCCGGGGAAG
GAGTTCGCTTCTCCACCTTTGTTGGTAATGAATAACTTTACTACTCCTCA
ACCACCGAACGCTGACGGAACGCCCGGGCGCCCACCCCCACACGAAGTAC
TGCTAACAAGCATGTTCCAATCACTTTTCCCGCCAATCTCCGCCCAGCGG
ACACCCCTCTCTTCGATCCGTCGTGTCCTCCTTCTTGACCGTCAGCTGAT
GCCATCAGATTCTGGCGATGCCCCATCAGAATATGTCATAGAAGCCCGAC
ATTACATAATTTCCACGAAGGCTGTCGGGCTATCAAAGCCAATCCGCCGC
CTCGACGCTGCACAGAGAGCCGTTCGCCAACCCAAGACCTCCCGGAGGGG
TGCGCTGCCGAACTTGGGTAAACTGGAGGATATTGCGGACTACATGCTTG
ACCCCGGCGCCGCTGGAGGATACACATCGGAAAGCGAAGTTGAAGAGGAT
GCAGAGGTTGAGGTTCTACAATCCGCGTCTAGCAAGCAGGCTCCTAGAAA
GAAACGCACTCCCAAGGGACCTGAAAAGCGCGTGGTAAAATTATCAGAGA
TTGGGCCTAGGATGAAGTTGGAGATGGTCAAGATCGAGGAGGGACTAGCG
GAAGGCAAGGTTCTTTGGCACGCATGGGAGATGAGGAGGGAGAGGATGAA
AAAATGGGAGACGAATGAAGGTTTTGTACAATGGTCAATCTTCTT

Sequences in the Contig:

SY0AAA28YA15FM1 SY0AAA47YI12FM1 SY0AAA6YI01FM1
SY0AAC16YG09FM1 SY0AAC49YF16FM1 SY0AAC7YI05FM1
SY0AAD20YA21FM1 SY0AAD2YF24FM1 SY0AAD52YO06FM1
SY0AAD57YK09FM1 SY0AAD62YG18FM1