Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1323
Length(NT) : 1011
Best Gene Model Blast : Link to GSTUMT00000913001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: cytochrome b5
Accession: ref|XP_001215211.1| Score: 353 E_value: 1e-31
KEGG Definition: cytochrome b5, putative
Accession: afm:AFUA_2G04710 Score: 347 E_value: 3e-31
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0537 Score: 265 E_value: 6e-24
PFAM Definition: Cyt-b5, Cytochrome b5-like Heme/Steroid binding domain. This family includes heme binding domains from a diverse range of proteins. This family also includes proteins that bind to steroids. The family includes progesterone receptors. Many members of this subfamily are membrane anchored by an N-terminal transmembrane alpha helix. This family also includes a domain in some chitin synthases. There is no known ligand for this domain in the chitin synthases..
Pfam Number: pfam00173 Score: 240 E_value: 4e-21
Swissprot: Q9P5L0|CYB5_NEUCR
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig1323
TTGGCTCGCATCTGCTCCAGTACGATATTGAGATAGAAAAGGACCTGGAA
AAAAATATTTTAGAAAGTCGAAAGGATTAAAACGAGTTAGGTCTGATTTT
AGAAGTCCATACCATCGAGGAATGATTATCCGGGGTCCAATGGTGAGAAC
TCGAGATGGTTGTTTATCCATGGAATTTGATTGGTTACCTGTCCTACCCT
AAACCAATTTAAAATGGGATGCGGCAACACCACTGCGGCCAGCCATCAGA
AAGGCGTTGAGGGCCATTCTCCAATTTTTATTTTTTTTATTAATTTTGTA
TTTTCTCGTGTCATATATACAGTGCCGGGTCTCTCCTTTCATTAGACACT
TTCCTTCCTCTACTCTCTCCCTCCATCGACCCGAACACCGTTACCACCAC
CGCTCGTCTCACTACTCCCCTTTAACGTCTTGTCGCCCCAAGCTCTACTC
TTTATAATTCGAACTATTTTCTCATTTCAGGAATATTTAACCTTACAAAA
TTGATCTGAATAGATTCTCTTCAAATCTCTTACCATGTCAGCCGAATATA
CCTTTGCCGATATTAAAGGACATCAATCGAAGAAGGATCTTTGGCTTGTT
GTCCATGATAAGGTCTACTCTTGTGGGGATTTTGTTGACGAGCACCCGGG
TGGTGAAGAAGTCCTGATGGATGTCGCTGGACAAGATGCGACCCTTGCCT
TCGAGGATGTCGGACATTCGGACGAAGCCCGCGAAATTCTTAACGGATTG
TTGGTTGGCACACTTAAAAGAACGGCATCCGACCCGAAGCCCCCTGTTAC
CTCTCCTAGTTTCACGACCCAGACACAGAGCAATGATGCTGGAACTACGT
TCTACGCTTTCTTCGTTGTGGCTGCCCTTGTTGCGTTTGGGGCATACAAG
GTGTACGCTTAAGTGGCCTGGTGTGGTTGGAGTTGTGAAGGGACAGTGGA
AAGAGAATTTGGGGTAATATGATCTCTTTTTCTTTTCTTTTGATTTGCGC
ATGGTGTCTCT

Sequences in the Contig:

SY0AAA47YI11FM1 SY0AAB14YK20FM1 SY0AAB28YE15FM1
SY0AAB51YA03FM1 SY0AAD2YO20FM1 SY0AAD40YC14FM1
SY0AAD56YB05FM1 SY0AAD57YH13FM1