Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1322
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00011904001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001537924.1| Score: 232 E_value: 7e-18
KEGG Definition: hypothetical protein ( (AL451017) related to MICROSOMAL GLUTATHIONE S-TRANSFERASE 3 [Neurospora crassa OR74A] )
Accession: ncr:NCU01320.1 Score: 229 E_value: 8e-18
KOG Definition: No Hit Found
PFAM Definition: MAPEG, MAPEG family. This family is has been called MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism). It includes proteins such as Prostaglandin E synthase. This enzyme catalyses the synthesis of PGE2 from PGH2 (produced by cyclooxygenase from arachidonic acid). Because of structural similarities in the active sites of FLAP, LTC4 synthase and PGE synthase, substrates for each enzyme can compete with one another and modulate synthetic activity..
Pfam Number: pfam01124 Score: 194 E_value: 5e-16
Swissprot: Q3T100|MGST3_BOVIN
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0004364 = Molecular function: glutathione transferase activity

Sequence:
>Contig1322
TTGGATTCTCAAATCAGCCCCCTCCATCTCAACCCTCCACCATAACAAGT
AACCAATTCACACCATGCCACTCTCTTCCGTCCCACAGGAGTACAGCTAT
GTTCTCGCCAGTCTCTTCGCAGCATCCTTGGTGAGCCAATACCACACTAT
TCTGGTTGGCGGTATCCGCAAGGCCGCAAAGGTCCCATACCCGAACGCCT
ATGCGAGTGCCGAGGACGCCTCCAAGGACAAGGAAAAGTTCCGCTTCAAC
TGCGCTCAACGTGCACATTCAAACTACCTCGAGAACCTTGCTGTCGTGTT
ACCAGCTTTCCTCGCTTCAGCGCTTCACTACCCCATCGCCTCGTCCTCGC
TCTTGGGTATCTGGCTTGCTGGCAGAGTGGCGTATGCTCGTGGCTACGCC
GGCAGCGAGCACAACGGCACCGGAAAAGGGAGGTACAAGGGTGCGTTCTT
TTATGTCGGGCAGATCGGGTTGGCAGTTACGGCTACAATGAGTGCGTGGA
AGCTCTACAGCTCTGGGCCTTAAACATGAGCATGGGTATTTTTTTTTTTG
GAAATAGGGTTGGGACTTACTTCTTTGTAGTGCATTTGGTTTCTTTCCTT
GTCTGGACTATAGCTATTGTTTTCCTTGGAGCATTAAATATACAAGAAGT
TTTCGTCTC

Sequences in the Contig:

SY0AAA47YH12FM1 SY0AAA47YM21FM1 SY0AAA60YE24FM1
SY0AAB19YC11FM1 SY0AAB25YK11FM1 SY0AAB28YO07FM1
SY0AAB29YL08FM1 SY0AAB39YK09FM1 SY0AAB45YO13FM1
SY0AAB59YK06FM1 SY0AAD36YG08FM1