Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1321
Length(NT) : 673
Best Gene Model Blast : Link to GSTUMT00003504001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1321
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCGAATACAGGCTCACTG
GAAGGGCTTTTCGTTTAAAAAGAAAAGGGTTGAAAGCTTCTTTCCCACGA
AACATACAACACCGTTCAGCTTGACTTCTCGATTTCTCGGAAAATTGATT
TGACGAGAGAAAAAAGAAAACCATACTCGAACCTGTCAGCCCAACGTTCG
GTTTCAGTTGAGCTCAGTTCAGCTTGGATATGGCCGCATCATCATCATCA
CAAGCACCCACATCGGCTTCAATACCTACCAAGGACACCACAGGAATGGC
AGACTTTGTGCTCTTTGATGATGACCCTTTATATCAGGAGTACCGACCGC
GCTACGACAATGGAGGATTCCCTCAGTCGGGTGTAGATTCTTACGTCGCT
ATGCTGGAACAACCGAGTGAGGATCATCAACCAAAGTTATACATGGCCGG
GCTACAGCCCGGCTCGACCTCCTTCGAGACCTACCCTCCATACGCCTACG
ATGAGGTACCATTGACCATGGGGTACGAGCCCGGACCAGCTCCAGGCGTG
TTGATTCACCCTCCCACCCTACCATACTCACCTCACGGCAACATCACAGC
GAGCCTGGAGTACCGAACACCTATTTCCCCGGCTACTTCGGCTGGCGGAC
CGGAAGGCAGCAGTGCTGGCTCG

Sequences in the Contig:

SY0AAA47YH03FM1 SY0AAA54YC19FM1 SY0AAA59YG15FM1
SY0AAB18YK02FM1