Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1320
Length(NT) : 1199
Best Gene Model Blast : Link to GSTUMT00002676001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: succinate dehydrogenase iron-sulfur protein, mitochondrial precursor
Accession: ref|XP_965152.1| Score: 1099 E_value: 1e-118
KEGG Definition: hypothetical protein
Accession: ncr:NCU00959.1 Score: 1099 E_value: 1e-118
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3049 Score: 1136 E_value: 1e-125
PFAM Definition: No Hit Found
Swissprot: O42772|DHSB_MYCGR
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0008177 = Molecular function: succinate dehydrogenase (ubiquinone) activity

Sequence:
>Contig1320
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAATACTTCCCCTCAATAA
CCGCCCTTACCCTCGCTACTCGCCAAATATTAGAGCCTCACCTACTACTC
TCTCTTTCTCTCCTCGTTCCTCCTCTCAACCACACATTGCTCTCCCCCAC
CTTATCATCCATACCCACATCAACTTCCGCCATGAATGTCACATTCCTCT
CCCGCTCGTTGCGCCGCGCAACTTTAACATCTCTCAAGCTCACCACTGGC
CTCCGCACATTAGCATCTGTCACAGCCTCCCAGACTGTCCCCGCCGGGTC
CGGTTCGAAGAAGGAAAACATCAAGCAATTCCAGATCTACAGATGGAACC
CAGACACACCCGAGAAGAAGCCTTACATGCAGACCTATGAACTGGACATG
GACCAGACCGGGCCCATGGTGCTAGATGCTTTAATCAGACTCAAGAACGA
GGTTGACCCTACGCTCACTTTTAGACGCTCTTGTCGCGAGGGGATTTGCG
GGAGTTGTGCGATGAATATACAGGGGAGCAACACTTTAGCTTGCTTGTGT
CGTATCGATGTCTCCAACTCTGCCCCTGTCAAGATCTACCCGCTTCCGCA
TACCTACGTCGTAAAGGATTTGGTTCCGGATCTTACACAGTTCTACAAGC
AGTACAAGTCTATCAAGCCATATCTCCAGCGCAAGACTCCCTCTCCCGAT
GGAAGGGAGTACCGCCAGTCCGTAGAAGAGAGGAAAAAACTTGATGGATT
ATACGAGTGTATTCTTTGCGCTTGTTGCTCGACTTCTTGCCCATCTTACT
GGTGGAACTCATCCGACTACCTCGGCCCAGCTGTCCTTCTCCAGTCGTAT
AGGTGGTTGGCAGACTCTAGAGACGAGGCCAAGGGTGCTAGAAAGAGCGC
TCTTGAGAATGAGATGAGCCTCTACAGATGTCACACCATCATGAACTGTA
CAAGAACCTGCCCCAAGGGGTTGAATCCTGGCCGGGCTATTGCGAACATA
AAAAAGGAGATGGCATTCGGTTCGTAGCAGTGGATCTCGAAAAACAAAAA
CCTAACACAATCTTTTTCAAGGCACACCAGCTTTGTCAACTGTTTTCAAC
AAGCTTTTGGTATAGAATAGTTGCGTCTAGTTTGCACTCTCTCCCGTTGA
TAAAACAGTGGCAGAGTGGTCTAGACCCTTTCCCGTTTTCTTTTTTTTC

Sequences in the Contig:

SY0AAA47YG06FM1 SY0AAB25YP07FM1 SY0AAC46YC09FM1
SY0AAC4YP10FM1 SY0AAC61YG24FM1 SY0AAD50YL10FM1
SY0AAD55YH07FM1 SY0AAD59YE07FM1 SY0AAD60YJ04FM1