Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig132
Length(NT) : 2232
Best Gene Model Blast : Link to GSTUMT00007443001 E-value : 0.0
Numbers of ESTs : 103

Blast Results:

Nr Definition: integral membrane protein
Accession: ref|XP_001268327.1| Score: 1109 E_value: 1e-119
KEGG Definition: integral membrane protein
Accession: afm:AFUA_6G12730 Score: 1077 E_value: 1e-115
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P25639|YCV1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0008361 = Biological process: regulation of cell size

Sequence:
>Contig132
TTGGGTAGATTATATGGGTCAAATTACTTTGCAATCCGACGAGTGCAATA
CTGTCAGCGAGAGAGAGAGATATGTTGAATCGGGCTGTGTTGTTTTGGCT
CGCGGGCCTGACAGTTTCATCTTTACAATTGGTCTCTGCTGGTGAGGAGC
ACCACCATCATCATGGTAGCCATGAACGCCACTCGGATCATAGCGCTCCC
CCAGCTCCTGGGCCGTTAGATACCCTCCCGTACTATTTTGCGCATCCCGA
TCATAAGGGACTGTTATATGGTCATGTTGCTCTTATGAGCGTCGGTTGGA
TCGTCGTCTTGCCCATAGCCGTTGTCCTCGCAATCGCAGGCTCAAGATAC
CACCTCCCAACCCAATTACTTTTCCTCATAATCCACGGTTCTGGCCTATT
CCTCTCAATCCTCTACAATAGTGCTACCCCAGATCTATATCCCAACAACT
CACATCACAAGCTCGGATGGGCCATCGTCTGGATATTAGCTACGCAGTCC
ATCCTGGGGGTCTTAGGAAGGACGATCCGGTTCGCACTCTGTGCCGGGAA
TCTCGGTGGTACAAGGGAAGAGACCTCCGGGTTTATCCCGGTGCCGGCGC
AGGATCCTGAGGATCATCATCATCACCGTACATTTCAGCGCCATTCTACT
GATAGTGGGCAGGGCTCGGATGAATATCGTTCTCGATCTCCATCTACCTC
ATCTTTGGAAAACCGTCGTTATGGGAATTTCGAGGGTGTGGATTTGCCGC
TTGCAGAGGGGCGTGCCAACGGGAAAGTGACGTTGGTGGAGCGCTTGACG
AGTACTAGTTGGCTTGAGTCGTTCCTGTCGCGGCACTTGCCGTATTTGCT
CGGGCTCAGGGTTTTGCGAATAAGCGACGCTTTGTATTCGCTTATCGCTA
GGTTTTTAGTTGTCTTAGGGTTCGTCCAGATATCACTCGGTATCGTGACG
GCAAGTGGAATATTCATGGAAAGTCGAGTATTCAATGGACTTGCGCATTT
CATAAAAGGCGGAATATTTTTCCTCTATGGCGTTTTAACACTCGGGCGCT
GGCTTGGTGCTTTTAGCGAGCTTGGATGGGCCTGGAACGTCAAGCCACCT
CAGGACTATGGCGGCAAGTGGAGGTCTAGAATACCCTCAGCTGAAATGAT
CGAATGCACCGTAATCTTTACCTACGGAGCTTCGAACGTATTCCTCGAGC
ATCTTGCTGGGCGGGGTGGCGCTTGGTCGCACGGAGACTTAGAGCACGTC
TCGATCGCTTTTATGTTCTTTGGAGCTGGCCTTTGCGGTATGCTTGTGGA
ATCGCAGTGGATAAGGAATGTCTTAAACCAGAGCATCATTACTCAAATCG
GTGAAATTAGAGGACCCTACAAACCTGGGGCCCCACGACAACCGAATACT
ACGGATCACAAGATGTCACTGAACCCTCTCCCGGCACTTGTGATATTCTG
CCTTGGGGTAATGATGAGCCAGCACCACCAATCCTCAGCACTGTCAACCA
AGATCCACGCTCAATGGGGAGCTCTTTTAGCCACGTTTGGCGTGTTCAGG
CTTTTCACTTACGTTCTGCTGTATCTGTCACCCTTGACCTCTTACTATCC
ATCCAGGCCCCCAACTGAAACCATCGGGTCGTTTTGCCTCATGGCAGGTG
GGCTTGTGTTTATGGCAAGTAACAAAGATACAGTTGCAGCACTAGAGCGA
GCGAATGGGGACGCAATGTTCGTCCTCACGGTGATTATTGGATCTACCGT
TTTGATCATGAGTTGGATAACTTGTGTAATGGCAATAAAGGGGTGGGCGC
TTCGAAAAGAGCAGCAGCAGCGCGCATGAGCCTACAACACACGTACCTGC
TTGAGACGCGGGATTTGTGGGAGTGGCGGTGTGCTAGCTACTGTAGCTAA
CATGACCTTTTTTGTGACGGGGGATTCTTTTTCCCACATGGTTTCACGTT
GTTCCGGGTCCGGCTCTAGCCCGGTTGTGGGTGTTACTTTTTTGGTCGCA
CAGGTCTTAAATTACAGTGCTTTTACTTGGATTTCAATCTTCCTCTTTTC
CTGCATACTGGTACGACATACCCTGTTACTCTTTTCATCCACTCACTCAT
TAGTATCGGGGGACGTTCTTTTCGTCAGACGAGAGAGGAGAGATTATCTT
AATAGTACTTATGATTTAATTATTTCCTGGTGCCGACGGATGTACCGGTT
TGTACGTAGCTAATGTGTGTACGAGTACGAGT

Sequences in the Contig:

SY0AAA13YO23FM1 SY0AAA14YP06FM1 SY0AAA15YC24FM1
SY0AAA15YE20FM1 SY0AAA15YK12FM1 SY0AAA17YK17FM1
SY0AAA18YE18FM1 SY0AAA18YE18RM1 SY0AAA20YM09FM1
SY0AAA20YM09RM1 SY0AAA21YA09FM1 SY0AAA21YD05FM1
SY0AAA23YG15FM1 SY0AAA24YG21FM1 SY0AAA24YG21FM2
SY0AAA24YP02FM2 SY0AAA25YO24RM1 SY0AAA26YF23FM1
SY0AAA28YB07FM1 SY0AAA29YC04FM1 SY0AAA29YL01FM1
SY0AAA2YK15FM1 SY0AAA30YA24FM1 SY0AAA31YD18FM1
SY0AAA32YK16FM1 SY0AAA35YI17FM1 SY0AAA36YF20FM1
SY0AAA37YO01FM1 SY0AAA38YH03FM1 SY0AAA38YN13FM1
SY0AAA38YP22FM1 SY0AAA39YA14FM1 SY0AAA39YA20FM1
SY0AAA39YL24FM1 SY0AAA40YD10FM1 SY0AAA40YJ19FM1
SY0AAA43YI02FM1 SY0AAA44YP01FM1 SY0AAA45YC13FM1
SY0AAA46YK21FM1 SY0AAA47YI04FM1 SY0AAA47YJ23FM1
SY0AAA47YN07FM1 SY0AAA47YO04FM1 SY0AAA48YG16FM1
SY0AAA50YM03FM1 SY0AAA52YD16FM1 SY0AAA52YI04FM1
SY0AAA56YD08FM1 SY0AAA57YD23FM1 SY0AAA59YM20FM1
SY0AAA5YL10FM1 SY0AAA5YP05FM1 SY0AAA60YM20FM1
SY0AAA61YA05FM1 SY0AAA61YJ21FM1 SY0AAA62YH09FM1
SY0AAA62YJ22FM1 SY0AAA63YF24FM1 SY0AAA9YH12FM1
SY0AAA9YO05FM1 SY0AAB10YB16FM1 SY0AAB10YM14FM1
SY0AAB12YA01FM1 SY0AAB13YP10FM1 SY0AAB14YF11FM1
SY0AAB16YE22FM1 SY0AAB17YP06FM1 SY0AAB18YD15FM1
SY0AAB18YG08FM1 SY0AAB18YM03FM1 SY0AAB19YD14FM1
SY0AAB19YE12FM1 SY0AAB19YL07FM1 SY0AAB21YJ07FM1
SY0AAB21YO24FM1 SY0AAB22YM14FM1 SY0AAB24YH08FM1
SY0AAB24YN07FM1 SY0AAB25YD07FM1 SY0AAB26YG21FM1
SY0AAB28YC03FM1 SY0AAB29YD24FM1 SY0AAB34YH15FM1
SY0AAB38YB21FM1 SY0AAB40YN15FM1 SY0AAB41YI17FM1
SY0AAB42YH10FM1 SY0AAB42YN13FM1 SY0AAB44YP20FM1
SY0AAB45YO17FM1 SY0AAB46YH04FM1 SY0AAB46YN17FM1
SY0AAB47YC14FM1 SY0AAB49YM10FM1 SY0AAB49YN04FM1
SY0AAB51YA16FM1 SY0AAB54YJ04FM1 SY0AAB58YK11FM1
SY0AAB58YO09FM1 SY0AAB61YO11FM1 SY0AAB7YA08FM1
SY0AAB9YB16FM1