Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1318
Length(NT) : 985
Best Gene Model Blast : Link to GSTUMT00012199001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: hypothetical protein CIMG_05817
Accession: ref|XP_001241921.1| Score: 506 E_value: 2e-49
KEGG Definition: hypothetical protein
Accession: mgr:MGG_12594 Score: 414 E_value: 6e-39
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3882 Score: 132 E_value: 1e-08
PFAM Definition: No Hit Found

Sequence:
>Contig1318
TTGGCTTCAACTCAGTCTTTCAAGGGCATCCATCGTCCATCTTCGCATTC
CTTTCGGTCTTCAACCGCCTGCCATTCTTTACTTTCGTTTTATTTCGTTT
CTCGCCCTTTCCGCATCACCGGAATCATCCCCACATTTCTCGCGACGCAG
GCCGTCTAATTTTCTGTTCGATTTTCAAGCAAATTTTCAACCTACACTCA
CCAGTCATTCTCTGTGGTTCAAGGGTTTCTGTCGATTTCTTCCCCTCTCT
TCCGGACAGGCTCCCCCGACCGATCTCACCGAACCTTAATTTGCGGGTTT
CGATAGCTCACGAAAGAAGGGGAGAGAAAAAGATCAAACTAAACGAGTCC
GAAAGAAATCGCGGAAAAATGGTCGGCTCAGTAGTGGCATACTATGTTGG
AACAGACATCATCTTCTTAGGAACCGGTATTCTGCTCATATCCGCTGCGG
CGATATGGCAAAAGGAGTTGACGGGGGATCCAACGATGGAATCAGTGGCA
AGATTTCTGCTGTTGAAGAAGGCCCCCCTTAGTGCTGTAATCGCAAATGG
AGTTATGGTCCTTGCCGCTTTCCTACTATCTTTACCTACTTTCGCCCTAC
CAACTTCGCGAGCATGGCTCAAGGCCCACGGCTGGTTGGTGATGGTGTGC
GCACTCTTCACAATGGTATTGGGATTGATGGAATGGGTCACAACCCTTAC
TACCCGGGCGAATCTGGAGACAATTTGGGGTCAGCAGACTCCTCAGATCC
AAAGTATGCTTCAACAAAAGTTCAGCTGCTGTGGATACCTGAACAGCACT
TCTCCCATGTACGTCGTAGATAGCGTTTGCACGAGTGACATTGTTGCAGC
ATCGAAGGAAGGTTGCGTTAGCCCTTTTGCAAACTATGCCGAGAGATGGA
TTAACCTTCTCTTCACTGCTCTTTTTGGCATTGTTGGGATGGATGCTGTG
CTCATACTATGCGCTGCGATGCTTATCCGGTACCG

Sequences in the Contig:

SY0AAA12YA09FM1 SY0AAA30YL20FM1 SY0AAA41YH22FM1
SY0AAA47YF07FM1 SY0AAB16YF24FM1 SY0AAB27YB11FM1
SY0AAB47YB15FM1 SY0AAB47YL07FM1 SY0AAB48YN23FM1
SY0AAB4YH22FM1 SY0AAC11YN13FM1 SY0AAC12YA01FM1
SY0AAC19YD06FM1 SY0AAC23YE23FM1 SY0AAC25YH18FM1
SY0AAC31YC08FM1 SY0AAC31YM13FM1 SY0AAC39YL11FM1
SY0AAC41YJ16FM1 SY0AAC42YJ09FM1 SY0AAC4YH16FM1
SY0AAC51YA21FM1 SY0AAC55YD23FM2 SY0AAC57YC09FM1
SY0AAC60YL06FM1 SY0AAD12YA04FM1 SY0AAD16YP22FM1
SY0AAD1YA14FM1 SY0AAD22YG24FM1 SY0AAD24YH21FM1
SY0AAD2YG10FM1 SY0AAD33YL12FM1 SY0AAD38YI22FM1
SY0AAD43YD11FM1 SY0AAD43YO13FM1 SY0AAD45YE24FM1