Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1317
Length(NT) : 951
Best Gene Model Blast : Link to GSTUMT00011295001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein An07g09120
Accession: ref|XP_001391986.1| Score: 1027 E_value: 1e-110
KEGG Definition: hypothetical protein
Accession: ang:An07g09120 Score: 1027 E_value: 1e-110
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2738 Score: 914 E_value: 3e-99
PFAM Definition: Peptidase_M24, metallopeptidase family M24..
Pfam Number: pfam00557 Score: 334 E_value: 4e-32
Swissprot: O59730|AMPM1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus
GO:0006413 = Biological process: translational initiation

Sequence:
>Contig1317
TTGGCCTTTAACCAACTCATCTCGCCTATTCGGATTCGTTCCCCAATCCT
CCTCGCCGTCCCTCCACCCAAGGGACCTTCTCGACAGAACCCCCACAGGG
AAAACCTCGCCCTCCGTTGTTCTTCATCCAGCACGCCAGGAGGCTGTCCG
GAACGAAAGAAAAGATGGCCACCGCAAAACGTCTCTGCATAGGAGTGGCT
TGTGCTAACCCCATATCTACTCTCCAGTGCCCAACATGTCTGAAACTTGG
CAAAGAGTCCTTCTTCTGCTCGCAGGACTGTTTCAAGACCAGCTGGTCTG
AGCACAAAATTATTCATAAACAGTCGGCCCAAACCGGAATTTACGACCCA
TTTCCCAACTTTCCTTATACCGGCGGCATACGTCCTGCATATCCACTCTC
CCCGACAAGAAGACTTCCCCCGAGCATCAGGCGTCCGGACTATTCCGAGG
ATGGAGTTCCCAAGTCTGAGCAGGCCAGGGGAGGTCCTAAAAACATCGCC
ATCTTGAGTGCAGAGGAGATTGGAGGCATGAGAAAGGTTTGCAGACTGGC
TAGGGAGGTTCTCGATATTTGTGCTGCGGCGGTTAGGCCTGGTATTACCA
CGGATGAGCTGGATGAGATTGCGCATAAGGCTTGCATTGAGCGTGATTCG
TACCCATCCCCGTTGAACTATGTAAACTTCCCCAAGTCTATATGCACTTC
CATCAACGAGGTTATTTGCCACGGCATTCCAGATCAGAGAAAACTGGTAG
ACGGCGACATCATAAACCTTGACATAACTCTCTATCACGGTGGCTTCCAC
GGCGATTTGAACGAGACATACTACGTTGGTGACAAGGCAAAAGCAAATCC
TGACACCGTACGAGTAGTCGAGACCTCAAGAGACTGTCTAGACGAGGCCA
TCAAACTCGTTAAGCCCGGCATGCTTTTCCGTGACCCCGGGAACGTCATT
G

Sequences in the Contig:

SY0AAA19YP24FM1 SY0AAA47YF03FM1 SY0AAB11YI07FM1
SY0AAB29YJ05FM1 SY0AAB41YG08FM1 SY0AAB60YP17FM1