Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1316
Length(NT) : 1807
Best Gene Model Blast : Link to GSTUMT00009922001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein ATEG_05311
Accession: ref|XP_001214489.1| Score: 863 E_value: 2e-90
KEGG Definition: hypothetical protein [EC:2.7.11.1]; K08269 unc51-like kinase
Accession: ani:AN1632.2 Score: 804 E_value: 8e-84
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0CLX3|ATG1_ASPTN

Sequence:
>Contig1316
TTGGAGACATGCGAAGCGCAATTCGACTGCTCGCGAGATGCGTCCGCTCG
AGGAGGAGCGAGTTGAGAAGGATTATGTTTTTGTGGATAAGCAGTTTGTC
CAGGTCAATGCCTTTGCAGATGAGTTCGCCACTGTTAGGCGGAATGGTAT
GACCCCACCGTCACCTTCTTCGAGCGCTTTGTCACGTAGACCAACATCTG
GGGGTCAAGGCGCCACAAATGCAATCGCTGTCACCGGCAGACGTCAGGAT
GGTGGATATCCAAGAAACTCGTATGAAAGACGGTATGGGCCTTCTCCTGG
CTCTGCTCCTTCTCCCTCGCCGAGCTCGACTCGGTCTGCGCTTGCTAAGG
CATTGGAGCTTGCCAACCTTCGTCTGTTTGGTGTTAGTATCTCACCTCCT
CGTCATAGCCCACCTGGTGTGCAGTCACCATACCCCACGTACCCGAATAA
TCCCACTAGCATGGTTATGGTTCGCAATGAGGGTGGTCCATCGGATGACG
ATATGCAAGCTGTATACAACATTGAGGATGCTGCCAGCAGGAGCGATGTT
GTTTACAATTTTGCTGAGGTTAAGCTTGCGCAATTGATACCTGCTGTGCC
AGCGCCTGTACATGGATTAGGGTTGCTCCCTCCATCAGCAAGCGAAGGGG
ACCTTGGACTTCCTGTTGAGCCTGCGCCGTCGAATGAGTTCGACCTTACC
CCCGATGCGGTTGTTCAACTCGCGGAGGAAGCACTCGTATTGTATGTCAA
AGCTCTTGGGATACTCGCGAAGGCTATGGATATTGCTGGGGCATGGTGGA
ATACCTCCAACAGGCGGAATAACCAAACATCACCAGCTATGTCAGCCGCG
AGCATGAGAATGAACAATTGTGTGCAGTGGGTCCGCGACCGATTCAACGA
GGTTCTTGAGAAGGCAGACTTTGTTAAGTGCAAATTGATCGAGGCTCAGA
AATTGCTGCCATCAAGTCACCCGAGTCACCCTAATAATCAGAATGATGAT
AGCGATGGATCCTTGGATGCTAGTGGTGATAGAGTTGTGGTGACGCCTGG
TGTCACCGCGGAGAAATTGATGTATGACCGCGCCCTTGAAATGAGTAGGG
CAGCAGCAGTCAATGAATTGGTTGGGGACGACCTTAATGGATGTGAGGTA
GCTTATGTTACATCAATCCGAATGCTGGAAGCGGTCTTGGAGAACGATTC
TGTCGACCAAAATGATGGAGACGTCCGCATGGAGGAAGAAGATAGAATGA
TAGTCGAGAGCTATGTCTCAAGCATCCGCAAAAGACTCGTTTCCCTCAGG
AAGAAGATGTCGGAGGTTTCCAAGCGGTCATCCGGCATCCATTCAATACC
AAGCTCGCCTTTACAGCCGTCCTCGTCTCCCCTGATGGGGGTCTCTCCTA
AGTAAAACCCGCGAGGTCGATTCACACCAGAGCATTGCGTCCCCTGCGCA
GGAATCGTGAGGGACAGAGGACATCAAATCTCTGCACAGCGCTCGCGAGT
TCTCTCTTTCTATCTACTTTTTTTGCATTGCAATGTCTATTTTGGGTTCT
CAGACACTTTTCTTTTTTGTACGAGATTGCCGGTTTGTCGTATTTCTTTC
GGGGGTTTCATTGGAGGATATGGTCGTGCGTTTTCGGCGTTTTTATCTGC
GTGTTCGTTCTTTACTCATTGACCTTCCCAGGGCCGGGATTTCAACCTTG
GCCAATTAAACTGGATGAAGACTATTTTATGATTTCTCACGATCTCTGTT
TCTTCATGCATCAAGCACATTTCATATAACTTCATGAATGTTTTTTTATT
TATTTAC

Sequences in the Contig:

SY0AAA40YM02FM1 SY0AAA47YE21FM1 SY0AAB34YD18FM1
SY0AAC22YB06FM1 SY0AAC26YL13FM1 SY0AAC57YI06FM1
SY0AAC60YC08FM1 SY0AAD24YF07FM1