Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1315
Length(NT) : 718
Best Gene Model Blast : Link to GSTUMT00008695001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1315
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGCGAATCAAACCACAACA
AAAAAAAAAGACAGTCTATTCAACAGCGAAAAATACACAGGCACTGCTGG
TACAGGCATACAACTTCGGTTCGATTACACTTAAAGTTTGCTGTGCTTCA
ACGTGCGGCGATTAACGGACATTTTTCAATATGGACAATACTTCCTCAGC
CGCAGTAATAGCTGAGCTTGAAGCTACTCCTCCAAGGAGCAAAGACGCAG
CAACGAGCACTGAACCCAAGGACGACGTCAAGGTCATGGTGGTTGGTAGC
ACTGAGCACGAGGGCCTCAAACTCCTTTCAGGAACAGAAAAGTCTGGGGC
AAACACTCAAATCCAAGAGGAAGTCAGACAGGCCAAAATGAAGAACCCAG
CGGTCCTGGTCAACCTCCCATCATCACCATCAGCTCAGGCATACGAGGTC
ACCCAGCAAGCTAAACCCGACGATGGATATTTCGAGCCCGTCTTCCCCGA
GGCAGAAGGGGCAGCCGCAGCAGAGGGGGCAACTAAGAAAAGCCCATGAT
CCTGAGACAGCATGTTTGAAAATTCATCAAGTTATTCACGGCGGCGACGG
TGTTATATTTTCTTATACCAACTAAGCTCAGCCACAGTTACTTAGTCATG
TTCCCATGTGTCTATTCCGTGCTTTTGAAACTTCTGGGGACTTCTGGAAA
CAGGATCCGGATGAACGG

Sequences in the Contig:

SY0AAA12YA12FM1 SY0AAA23YE22FM1 SY0AAA47YE14FM1
SY0AAB10YD23FM1 SY0AAB58YK14FM1 SY0AAB61YL03FM1
SY0AAD53YD08FM1