Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1314
Length(NT) : 1410
Best Gene Model Blast : Link to GSTUMT00008417001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1314
TTGGGCGGTACTGTAATTGTTCAGCTCGTGGGTATATCTCGGTTTCAGTA
CAAACACCACAGTTTCAATCGCTTCCAGATCATCGATAATTCAGTGGCGG
GCAGTCAGCGCCTCCAGAAATGTCCGTCCATTTGCCCCTCCATTTGGCTC
TTCTCCTCGTACCTTATTTGGATCCCTCCGATGTGGCTCGTGCTCGGCGA
GTATGTAAATCCTGGTATCCGGTATTCTCATCAAGCACCCTTGCTCAAGC
AACACTCCGAGTTCACTATCCACTCTGTCGCGAAATCCGTACACCCTCAC
GCTCCATTGATTCGTCAGTCCTTAACCATGTTGGAAAGCGTTATGCTGCT
CTCAAGTCCGGACTTCCTCAGCAAGAGCTTCGCATCCCAATCACAAAAAC
CCGCAGAAATGGTTGCATCTGGACATTTTCTGAGAACCTCATTGTAGCCC
AAACCCGCCATCATCCAACCATCCAACTAGCACTGGTTTACCTAGACACT
TCCGGAGACACAAGACACATACGCAATGGGAGGGTGATGATAAGTGCTAA
AGGGGAGACTTCGGTTGCTGTCAAGGTTTGCCGAGACGTTCTGGCAGTTG
AAAGATCTGAGGAGCGAGTAACAAACCCCGGCCGCTCCGATTGGGTTGCC
GTTGTCAACTTTTTCAGGCTCTCGCTCGAAGGAGAGGACGCAATCGTAGC
CACAGATATATCCACCATCAGCACCTTCGAATTTACATACATTGATTACT
CCCACCAAATCAGGAGTGATCATTCCGGAAAATATTACGCTGCATACTCG
AGAGCAGAAGCCTCCCGCAGTGGTGGCATGCTTTGTGTTTGGGATATCGA
GACGGGTAGAATGGTTCGGCGTGTCCCGGCTGCCTCCCTAACCGGAATAG
TCATGATTACAGACGTGGTTGTCGCTGCGAAGCATGGATCTGAGGGCCAA
CAACACGTGGTAGTTGCTGGAAATGATAAACGTAACAACAATGCAAACCG
CTGGGGAAGATTCCCAGGGGAGTGGGGCTATCTCTTCAGCTTCAAAACCT
TCACCATTGAGGATGATTCCAAGGAAATGGAGTGGAGCGGGTTTGTTGGA
AGAACCAAAGCAGCAGCCCCCCGTGAATCGAACATTCTAGCCACTACTTT
CAAGGTACCCCGCTTCCCTCATGCCATCTCGCCAGTAGACGCTTTTGACA
CACCCGGATATGAGGCCGAAGACGTCGGACTTGCTCTCTGGGAACTAAGG
GACCGCTCAGGACAAGCAACTTCTTACTACTACAAATTATCCCCCGATGC
CCATCCGAAGTCCACCACAGATGCCTCGCTAACCGCAGACTTGGAATACC
GACTGCCGGAAGGAGCCTCCGCCTCTGGCCTTCCTGCGCCTTTTACAGTT
AAAGGCCGGA

Sequences in the Contig:

SY0AAA12YH23FM1 SY0AAA14YP15FM1 SY0AAA19YC07FM1
SY0AAA25YN20FM1 SY0AAA37YK11FM1 SY0AAA47YE02FM1
SY0AAA5YN11FM1 SY0AAA5YO16FM1 SY0AAB1YD16FM1
SY0AAB1YO18FM1 SY0AAB46YD04FM1 SY0AAB49YL21FM1
SY0AAB53YE12FM1