Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1313
Length(NT) : 563
Best Gene Model Blast : Link to GSTUMT00008493001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: pantoate--beta-alanine ligase
Accession: ref|XP_001216317.1| Score: 320 E_value: 3e-28
KEGG Definition: panthothenate synthetase [EC:6.3.2.1]; K01918 pantoate--beta-alanine ligase
Accession: aor:AO090026000745 Score: 318 E_value: 3e-28
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG3042 Score: 184 E_value: 6e-15
PFAM Definition: Pantoate_ligase, Pantoate-beta-alanine ligase. Pantoate-beta-alanine ligase, also know as pantothenate synthase, (EC:6.3.2.1) catalyses the formation of pantothenate from pantoate and alanine..
Pfam Number: pfam02569 Score: 200 E_value: 8e-17
Swissprot: Q2JRH9|PANCY_SYNJA
Gene Ontology:
GO:0005524 = Molecular function: ATP binding
GO:0004127 = Molecular function: cytidylate kinase activity
GO:0004592 = Molecular function: pantoate-beta-alanine ligase activity
GO:0015940 = Biological process: pantothenate biosynthetic process
GO:0006220 = Biological process: pyrimidine nucleotide metabolic process

Sequence:
>Contig1313
TTGGCAGACGGTTGTGCTTAGGCGGATGGTTGGCGACTTGCATGTTCCTA
CGAAGATCAGAGTCGAGGATACGATCAGAGAGGAAGACGGGCTGGCGATG
AGCTCTAGGAATGTCTATCTTGGTGAGAAGAGGCGGGGCTTTGCGGTGTG
CCTTTACAGGGCTCTTAAGGCTGCAGAGGAAGCATACCTTCAAGAAGTAG
CGAAGGGGGCTGCAGTAATTCCGAGATGGGTTCTCACAGAACCTGCTGAG
AAGATACTCGCAGAGGCCGGAAGTGATGAGGTTAGAACTGAGACCGAGTA
CTTTAGCGTTGCCTGTCCGAGGGAGTTGGAGGAATTGGAGCAGGTGGATG
TTAATGTGGGCGCAGTATTAAGTGGTGCTGTCAGGATGTTAGCAGCACAG
GAGGGCGAGGGCCCGGTTAGGATTATCGATAATATCATCTTGAAGGGTAA
AGCAGAGACCGGAACACAACGAGAACAGGCATCGCAGGATCCGAGGACCG
TAGTCGACGTTTAAAATAAATAAAAAGTTAATCAGATTTTAATGTATTTT
TATTATTACCTAG

Sequences in the Contig:

SY0AAA20YG01RM1 SY0AAA47YD11FM1