Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1312
Length(NT) : 729
Best Gene Model Blast : Link to GSTUMT00011158001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein An16g08560
Accession: ref|XP_001398154.1| Score: 283 E_value: 1e-23
KEGG Definition: hypothetical protein
Accession: ang:An16g08560 Score: 283 E_value: 5e-24
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG4414 Score: 228 E_value: 7e-20
PFAM Definition: No Hit Found
Swissprot: P0C624|CSN8_EMENI

Sequence:
>Contig1312
TTGGCTAAGCTTGTCGACAGTTGGGCAGGAGGGTCCTACAACAATCTCCC
CCTACCATAACCATAATACCGTATTATAGAAACAAAGTCGAGCAACAAAC
CGAGCTCCATCATAGGTTTCCTTCAAGCCCAGCAGACAACTTCCTCCACC
CGCACTTAACAAAAGCCATCCAGAACCATGTCTGCGGAAAAGGATGCTCA
AAAGTTCTCCCTAGCCTACATCTCTATCCTCGCATCCTCTGAGGCACCCT
CAACCATTGTTGAGATACTCGCAGATCTAGAAACAGAAGCAGCTTTGACT
CCCTTCTCATCAGACTCTGCCATCCTTCTATCAAACTTTTACGGCATCTA
CTTCTTCGCCCTTTTCCTTTGCGATGACTTAAATGAAGCACGCTTCCTCA
GCAAGCGTATCCCCATGCCAGCGCTCCAATCCGACCCACTGCTGATTAGC
ACATACACACTCCTTCGCTTTCTCTACACCAGGAACTACGCTGAGATCTA
CACCGTCATCGATTCCGCTCCCTGGTCCGAGCACGTCAGCCCTCTCGTCG
TCCGCTTCAAGGACTATTATCGACAGAAGACGGTGTTGCTGTTGTCGAAG
GCATACTCGAGCATTTCTCCCGTTCACGCAGCCGTTTACTTGGGCTTTAA
GGGCGACGAAACCGGGTTGCTGGAGTACATCGCACAGAGGGGGTGGTTGC
TGGATGAGAGTGGGCTTTTGAAGCCGGCG

Sequences in the Contig:

SY0AAA47YD10FM1 SY0AAA58YH03FM1 SY0AAB4YP01FM1
SY0AAD19YM12FM1 SY0AAD50YP10FM1