Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1311
Length(NT) : 717
Best Gene Model Blast : Link to GSTUMT00012000001 E-value : 1e-81
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein An04g02250
Accession: ref|XP_001401593.1| Score: 140 E_value: 3e-09
KEGG Definition: hypothetical protein
Accession: ang:An04g02250 Score: 140 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1311
TTGGGATACTCAAGTGCACCAAGTGAGTCCACCACAAATTCACTCTAGAG
TGTCATAAACCCACTCCAGCCTCGTTTGCGCAACCCGTACGCGTGCCCGC
CCGCCAACTCATCTTCCCTAATCCACCACCTATATCCCTACCAAACAAGT
ATGCCACAGACACCTTTGGATAAGATGCTTACTTCGAAAGATGCTTTCTT
AGGTTTCTTCCCCGTCCAGCTTCTCCCCAAACGACTGCTACCCAGCTACT
GTACCCCATCCAACATTCTCAGCAATGGTCATAGCAGTATCCGCCTGGTC
AATAATGAAGCCGGACGTAGACTTGAGTGTACTTGGCGATCCTACTGGTG
ACCCGGAAGAATGGACGGTTGGCGAGATGGAGGTGTGGTTGGGGAGGAGA
GGGCTAGAGACTTTCGGCACTCGTGAGGAGGTACTTGAGAGGGTTAGGAT
GTGCATGCGGGCGAGGAAGTAGGGGCGTTTTAGGCGACGGTTGTGGATAG
GATGCACAAGGTGGCGTATCGAGAGGCGAGCTGGTCATGCGTATGCGTCT
GGTACGATCTGTTGCTATTGTGGGGTATTTTGTAAGTGCGATAGTGGCGG
TGGTATGGTAATTTGGCTTGTTGGAGTTCGGGACACGATTTGGATATGGG
AAATTGTTATCAACTTTTCCTCTAACTTTTCAAGTAAACACAATACCTGT
TAAATCTCTTTCTACCT

Sequences in the Contig:

SY0AAA40YM07FM1 SY0AAA47YC22FM1 SY0AAD41YC09FM1
SY0AAD49YN18FM1 SY0AAD56YJ04FM1