Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1310
Length(NT) : 2248
Best Gene Model Blast : Link to GSTUMT00000548001 E-value : 0.0
Numbers of ESTs : 28

Blast Results:

Nr Definition: hypothetical protein SS1G_11184
Accession: ref|XP_001587942.1| Score: 1978 E_value: 0.0
KEGG Definition: phosphate:H+ symporter; K08176 MFS transporter, PHS family, inorganic phosphate transporter
Accession: afm:AFUA_4G03610 Score: 1904 E_value: 0.0
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0252 Score: 1411 E_value: 1e-156
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 450 E_value: 4e-45
Swissprot: P25297|PHO84_YEAST
Gene Ontology:
GO:0005887 = Cellular component: integral to plasma membrane
GO:0005315 = Molecular function: inorganic phosphate transmembrane transporter activity
GO:0005384 = Molecular function: manganese ion transmembrane transporter activity
GO:0006828 = Biological process: manganese ion transport
GO:0006817 = Biological process: phosphate transport
GO:0006797 = Biological process: polyphosphate metabolic process

Sequence:
>Contig1310
TTGGAAGGAAGTTCTATCATACCATTACTCGTACTCCACCACCCTACCTC
ACCACCACTGCCGACCCAAAGCTCTTCTCTTGGTACTTGGCGAAGGCTTG
ATTCTGCCCTTTTGTCCAAATAGCTAGTTGTGCTCGTGCAGTAGTGGGTC
TTTTATTCATTAGCTTTTTTCTTTTTTTTTCCATCTACTTGTAGGTGTTG
GATGAGATTGTGGGGAGCCTCTCGCCAATACAGGTCCAGCGCTGCACAAT
TGAGCTGACACCGTCGATATTGAGAAAGAAACGGCTGCAGTGGTTCCGTT
AGACAAGAGGGAAGAGGAAAGGGAAGGGAATCAGAACAATCACAGCCATG
AACAAGACTGCGGGTGGAAACTCGGCTTTTCACAACTTTAATAATCAGTT
TGCTCATGTTTCGGACCCGAACGAGCGTCGTCGTCTCGCCCTTGCGGAAA
TCGATAGGGCGCCATTTGGGTGGTACCATGTGCGCGCAGTAGTGGTTGCG
GGTGTTGGCTTCTTCACTGATGCCTACGATATCTTTGCCATCAATATGGT
GACTGGAATGCTTGGCCTCGTCTATTGGAAATCCGGAAAGATTCCAGAAC
ACTCAGACACAGCCATCAAGGTTTCTACTTCTGGCGGAACCGTGATTGGC
CAGTTGCTATTCGGGTGGTTGGCCGATGTGGTTGGCCGGAAAAAGATGTA
CGGACTTGAACTTTTGGTAATTATTGTTGCTACCCTTGCTCAGGCCCTCA
CCTCCGAGTCCTATTCCATGCATCTGGTGGGATTGCTGGTCTTCTGGAGA
GTGATTATGGGAATTGGTATCGGAGGAGATTACCCCTTGTCCTCTATCAT
CACTTCCGAGTTCGCAACCACAAAGTGGCGTGGTGCCATGATGGGCGCCG
TGTTTGCCATGCAGGGAATTGGCCAACTTGCCGCTGCGCTGGTAGCCCTG
ATCGTCACCGTAGCCTTCAAGTCCCAAACCCACCCCGCAGCCAAACCCAG
CCAGTGCGATGTCGCCTGCCGCACCGCTGTGGACAGAATGTGGAGGATCG
TCATCGGATTCGGCGCCGTTCCTGCATGCATAGCCCTCTACTACCGCCTC
ACAATCCCCGAAACCCCCAGGTACACTTTCGATGTCGCCCGGGATGTTGA
GAGGGGTCAGGCAGACGCGAGTGCCTACCTCGCCGGCAAGGCAGCCGGAG
AAATTGATGAGATTAGACGCGTCGAGGCGATGCAGCAGTCGGCCGATCTC
CAAGTGCCCAAGGCTTCATGGAAGGATTTTTGGGGCGTTTTCCTGCAGTG
GAGATACGGCCAGATCCTACTTGGGACTGCTGGATCATGGTTTTTACTCG
ATGTGGCCTTCTACGGTTTGGGTCTCAACAACTCCATCATTCTCGCTGAG
ATTGGATACGCTGCGAAGGACAATGTATACGACCGTCTCTACAATAACGC
TGTGGGAAACCTGATCCTCATTTGCGCCGGTGCGATCCCGGGATACTGGG
TTACTGTATTCACGGTGGACATTGTCGGCCGCAAGCCAATCCAAATGATG
GGCTTCGTCCTGCTAACGGGGTTGTTCATTGTCATCGGCTTCGGATTCCA
CCACTTGTCCTCAAATGCCCTGCTGGGACTGTACATCCTCTGCCAATTCT
TCTTCAACTTTGGTCCCAATGCTACCACCTTCTTGGTGCCAGGCGAGTGC
TTCCCGACAAGATATAGATCCACATCCCATGGAATTTCCGCCGCAAGCGG
CAAAGTTGGCGCAATCATCGCGCAAGTCCTCATCGGCCCCCTCAGGACCA
GGGGCGCCACGGCAAAGAACGCCTCACCTTGGCTGAATCACGTGATGCAG
ATTTTCGCTGGGTTCATGTTTGCCGGGATCTTCACTACCCTGCTGATTCC
TGAGACTAAACGTAAGACCCTCGAAGCACTCTGCGCAGAGCTGTACGGCG
AGGGTATTGCCCAGGAGGAGAAGGCTACACACACCGGTACCGCCGGCGTA
GGAGAAGCTACTTCTGAAGAGGCGGGTAACGAGAAGCGGGTCATGGTTGC
GGAGGGGCAATAGTGGGGCTTCCAGATTTACTTTACATTCATTGTTAATC
TTCTTATTTGGGGTTTGTTGCGTTCATGCTTGGGGTTGAGTTTGATGGTC
TACCGTAGTTTTGAGATAATTATCGGAGGTTGGTGAACGGCGGGCATGGG
ATGACATCTTCGTTTGACCCATGGAATCAATAAATACCCCTTTTCTTC

Sequences in the Contig:

SY0AAA20YN15FM1 SY0AAA3YP23FM1 SY0AAA47YC13FM1
SY0AAB1YE14FM1 SY0AAC17YH22FM1 SY0AAC18YN04FM1
SY0AAC22YJ19FM1 SY0AAC25YB09FM1 SY0AAC28YH11FM1
SY0AAC28YM08FM1 SY0AAC32YM04FM1 SY0AAC32YM22FM1
SY0AAC38YE06FM1 SY0AAC43YC10FM1 SY0AAC46YO18FM1
SY0AAC49YD18FM1 SY0AAC5YI22FM1 SY0AAC60YF16FM1
SY0AAC7YN08FM1 SY0AAC9YF07FM1 SY0AAC9YL05FM1
SY0AAD12YH18FM1 SY0AAD22YN07FM1 SY0AAD24YD20FM1
SY0AAD48YN11FM1 SY0AAD52YK08FM1 SY0AAD62YC06FM1
SY0AAD63YM01FM1