Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig131
Length(NT) : 967
Best Gene Model Blast : Link to GSTUMT00004552001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_03460
Accession: ref|XP_001244019.1| Score: 762 E_value: 5e-79
KEGG Definition: mitochondrial chaperone BCS1, putative; K08900 mitochondrial chaperone BCS1
Accession: afm:AFUA_3G13000 Score: 755 E_value: 2e-78
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0743 Score: 469 E_value: 1e-47
PFAM Definition: BCS1_N, BCS1 N terminal. This domain is found at the N terminal of the mitochondrial ATPase BSC1. It encodes the import and intramitochondrial sorting for the protein..
Pfam Number: pfam08740 Score: 465 E_value: 3e-47
Swissprot: P32839|BCS1_YEAST
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0009060 = Biological process: aerobic respiration
GO:0051131 = Biological process: chaperone-mediated protein complex assembly
GO:0007005 = Biological process: mitochondrion organization and biogenesis

Sequence:
>Contig131
TTGGGTGATAATCGAGGGGGGGATTCTTCTACGGGTTCGGCGGTTGATGC
ATCCGGTGGGGATGGTGGTCTCGTGGGCCAATTGAGTTCGAATCCGCTAT
TTACAGGAGTACCTTACCTCCGCTATCGCGGGAGCCTATGTCACTGACGG
GAATCGAAGGGAGTAGGCATAATCCTCCTAACCGCAGCCGCACAGCTCGC
CCGCAAGTCGTTAACGAGCCTGAGCACACACCTCCGAAATCAAATGCTCG
TGACGCTGGAAATACCTTCGACGGATAAGTCATACGATTGGTTTCTGCAC
TGGATGTCGCAGAACTCCTCCTCCTCTTCGTCGCCCCGGTCGACGTCCAA
ATCGTTGCTGGAATGGATGACGACCTTTCGCCCAGCCCCGCGACACCTCG
CTGTCGAGACGAAATACATCCGGCACGCCTCGGGCGGTATTTCCACCGAC
TTCACACTCCTGCCCGGCACCGGTCGGCACTTGCTGAATTTCCGCGGGAA
CTTCCTGAGGGTTAATCGCGAGCGCGACGCAAAGCGGGTGGACCTCCAGC
GCGGCACGCCCTGGGAGTTAATCACCATAACCACCCTCTTCGCATCCCGG
AGCGTCTTCCCGGCCCTGCTCCAGGAAGCCAGGGACCTGGCCGTGAAGCT
GGAGGAAGGCAAGACAATAATATACACCTCCTGGTCAACGGAGTGGAAGC
CCTTCGGCCGACCCCGGCGTAAGCGGCCGTTATCCTCCGTTGTGCTGAAG
CCAGGCCTCAGCCAAGAGTTACTCACCGATGTAAAGTCCTTCCTGAACTC
TGCCCGCTGGTACTACGATCGCGGGATACCCTACCGACGGGGATACCTCC
TTTACGGCCCACCCGGCACGGGAAAGAGCTCGTTCGTGCAGGCGCTAGCG
GGCGAACTGGATTATGGCATTTGCTTGCTGAATCTGAGTGAGCGTGGGTT
GACGGATGATCGATTGA

Sequences in the Contig:

SY0AAA14YN20FM1 SY0AAC10YM04FM1