Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1309
Length(NT) : 1609
Best Gene Model Blast : Link to GSTUMT00002630001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein An12g01490
Accession: ref|XP_001395236.1| Score: 1004 E_value: 1e-107
KEGG Definition: hypothetical protein
Accession: ang:An12g01490 Score: 1004 E_value: 1e-107
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2819 Score: 373 E_value: 3e-36
PFAM Definition: UPF0183, Uncharacterised protein family (UPF0183). This family of proteins includes Lin-10 from C. elegans..
Pfam Number: pfam03676 Score: 413 E_value: 6e-41
Swissprot: Q9SD33|U183_ARATH

Sequence:
>Contig1309
TTGGCCGCCTCGTAACAAACAAACCACCTTTACTCTCCTTGACACCCTCC
CCCCTCTTACAACAAAGCTCTGCCTCCCTTCTGTAGAACAAACTCCCGCT
TTTAGCCATGGCTTCCTCCATCGAGGGAACTGCTCAGATACAACCAAGCA
AGGCTCTAGGATTTCTTGTTCTTGGTTCTTCTGTATACGATGTTCTTAGT
CGTCTCCGTGCTCAACACCGCATATTTCCCTCCATCTCGGTAATCTATGA
CTCTGCTGCACCGTTAGCTTCTCCGATCGTACTCATGCTTGATTCCAACG
GTCTACGTCTTCGTTTCGATGGGCCAGACCAACGCCTCCGGCTCATCGAA
GTGCTAGACTTTCAGAAATCCAGATTGTCCTATAATAGCGGTGAACTGAC
CAGGCCTGGAATAGGGGCGGGGGGTCCTACTTTTCGGAGCATTTACAATA
AGCTTTTTGGACCCACATATCCAGGAGAATACATGGAGGGCGAGGGTGTT
TATGTGCTATCGTATCCTGGAGTTGCGTTCTCATTCCCAATCGGTAGGGA
AGCCTGGAAGGAAGGTGCGGATTTCGTATCTGTGCTCTCCTCACCAGACG
CCCAGCCTGCCAGCAGTATGGCTATTTTTGCTGGTTCGTCCTGGCTAGAG
GCACGAACTGGCTTATTCACCCGACCGGTACAGAACCCAAGATCACCTCT
TGTGAGTGGAGCCAGTGCTAGGTTGTCTTCTGCGAATGATGAAGTGGAGT
TTATCAAGTTTCGTGATGAAAATAAGGTGGAAATAACTCGCCGGCATAAC
CAACCGTTTTGGATTACATTGCACTCGACCACCCCTCAAGACCTTATCAC
AGAGCTAGGTCCTCCAAGCGCAATATACCGGAAGCACGATCACAGGCTAT
CCATTCACAGAACTAGATCACTATCCGGGGGCGTAAGTGGAAGAGGCCAC
CAAGATGATACGGATGATACGGAGCCAGAAGACGCTCAATCTGACGACGA
GGAAGATGTGTCCGATGTCTCCGCGACATCAAACAGCGATTACTTCTACA
ACTACTTCCACCACGGAATGGATATATTCATATCTGCAACCCGCTCATCT
TCGCACCCAGTAGCTACCAAAATCATCATCCACGGAAACGTACCCGGGAG
TTTCGAGTTTCAAGGATACCGACGAGCCCGTTGGAGCATAGAGCTCGCGG
CAAGCTCCAAGATGGCAAAGGAGCTACGGCTGCACAGTGAGATGGGATTC
GATGAGGCGCTGCCCCTATTGCGCGAAAAATTCGGAGAAGGGCAGAGACC
TATGCCCTTGAACCGGGGGAGTGATTCGCCGAGTAGTAGTTGTGAACTAT
TGGGTGGATGGGAAGATAATGAAAGCGCAGCTGATAAGGTTGATGTCAAG
GGTGGACCTGGTGGAAGTGAAAGCACATTTGGTAATACAGAACTATACGG
GTTTCCTGGATTCATATTTGAAGTCCTGAGGAATAAAGCGATATCATCTC
TGACGGTATTCTAAGCAAGTTGTGATTGCCTTGTGTCGAGCGCGGTCATT
GCCGGGGGTTGCTAGCCCTGTGAGATGTTTATTTCTAATCTATATCCTGA
CCCCCCCCC

Sequences in the Contig:

SY0AAA23YE08FM1 SY0AAA2YG05FM1 SY0AAA33YH20FM1
SY0AAA44YG07FM1 SY0AAA47YC03FM1 SY0AAB17YJ23FM1
SY0AAB48YB03FM1 SY0AAB6YE12FM1 SY0AAC56YM11FM1
SY0AAD7YN04FM1